FIG. 3.
Quantitative real-time PCR analyses of viral DNA synthesized by virions containing wild-type SNV NC or chimeric NC. (A) Primers and probes used in the analyses. R-U5 DNA was amplified by primers RU5-Fn (5′ TCCCAATAAAGCCTCTTGCTG 3′) plus RU5-Rn (5′ AGGAGACCCTCCCAAGGAAC 3′) and detected with probe RU5-Pn (5′ FAMTTGCATCCGAATCGTGGTCTCGCTAMRA 3′). U5-Ψ DNA was amplified by primers U5Ψ-Fn (5′ GCCTCTTGCTGTTTGCATCC 3′) plus U5Ψ-Rn (5′ GTCTCCAAATCCCGGACGA 3′) and detected with probe U5ψ-Pn (5′ FAMATCGTGGTCTCGCTGTTCCTTGGGAGTAMRA 3′). (B and C) Summary of viral DNA measurements from three independent sets of experiments. R-U5 and U5-Ψ DNAs are shown in panels B and C, respectively. DNA copy numbers are shown on the y axes. Black bars and white bars represent DNA synthesized by pRD136- and pSgpMcb-derived viruses, respectively. Standard errors are also shown for all the measurements.