TABLE 1.

Comparisons of MLV vector RNA in cells transfected with MLV- and SNV-based gag-pol expression constructs and in cell-free virions^a

Expt	% MLV vector RNA
	MLV basedb						SNV basedc
	Cellular			Cell-free viriond			Cellular			Cell-free virione
	pWZH30	pMgpSnb	pMgpScb	pWZH30	pMgpSnb	pMgpScb	pRD136	pSgpMnb	pSgpMcb	pRD136	pSgpMnb	pSgpMcb
1	100	160	167	100	43	54	100	77	62	100	154	186
2	100	107	127	100	36	28	100	54	119	100	101	138
3	100	66	180	100	111	87	100	78	105	100	84	143
Mean ± SE	100	111 ± 27	158 ± 16	100	63 ± 24	56 ± 17	100	70 ± 8	95 ± 17	100	113 ± 21	155 ± 15

^aThe primers (5′ ACGAGGTCGCCAACATCTTC 3′, 5′ AGCGCGTCTGCTGCTCC 3′) and probe (5′ ^FAMTCTGGAGGCCGTGGTTGGCTTGTA^TAMRA 3′) used in the analyses are located in hygro.

^bAll RNAs were standardized to the amount of RNA in the pWZH30 samples.

^cAll RNAs were standardized to the amount of RNA in the pRD136 samples.

^dRNAs from the pWZH30-, pMgpSnb-, and pMgpScb-derived samples with similar amounts of RT activities were used in these analyses.

^eRNAs from the pRD136-, pSgpMnb-, and pSgpMcb-derived samples with similar amounts of RT activities were used in these analyses.