TABLE 1.

Primers used in this study for RT-PCR and site-directed mutagenesis

Primer	Sequence (5′ → 3′)a	Location in the genomeb	Polarity	Purpose
E272	ATGAAGATCTACGGCTGC	10701-10718	+	ORF5 PCR primer
E280	GCGTAGCATAGGGTAGTACTG	11525-11545	−	ORF5 PCR primer
E301	CCGTCAGCATGCTCAAGGTGAAG	11234-11257	−	Cys-34 → Ser mutation in GP5
E302	CAACAGGTTTTGCTAGCGGAAGAATTGTACAAAG	11303-11336	−	Cys-57 → Ser mutation in GP5
E303	CAATACCAACTAGTTTTACTGG	11321-11342	−	Cys-63 → Ser mutation in GP5
E304	CGTCCAGGAAAGTACTATACCAACAG	11331-11356	−	Cys-66 → Ser mutation in GP5
E305	CACGTTTGGTACCGATTCTGATGACACC	11367-11394	+	Cys-80 → Ser mutation in GP5
E263	CATGCCCCCTTTTATTTACT	11460-11479	+	ORF6 PCR primer
E163	CCACCAGTTGGCGATGGTTG	12185-12204	−	ORF6 PCR primer
E306	GATTCATTTTCCGGAGACGGGATTTTAG	11913-11940	+	Cys-8 → Ser mutation in M
E336	GGCGGAACACTGGTACAAAGC	11302-11322	−	Asn-56 → Gln mutation in GP5
E363a	GGTTTTACTGGCGCTGCAGCCGTACAAAGCAGT	11299-11332	−	Asn-56 → Gly mutation in GP5
E363a	GGTTTTACTGGCGCTGCAGCTGTACAAAGCAGT	11299-11332	−	Asn-56 → Ser mutation in GP5
E364	GGTTTTACTGGCGCCGCAATTGTACAAAGC	11302-11332	−	Ser-58 → Gly mutation in GP5
E123	GCCCATGGCCAAGTAGGCCCCG	11625-11646	−	RT primer

^aMutated nucleotides are depicted in bold, and (translationally silent) restriction sites engineered to select and identify mutants are underlined.

^bGenome positions are based on the sequence of EAV full-length cDNA clone pEAV030 (EMBL database accession number Y07862).