Table 1.

Structure of validated novel transcripts.

Clone name	cDNA end sequence length	Chromosome coordinate	cDNA end orientation	Hit type	Gene	Primer sequence	Tm (°C)
MCF7_RNA_L_18_D17	310	chr2:55448021	Plus	E	MTIF2	aggaacctgtgcatctttgg
						aaagcagcatgtcctggagt	58
	553	chr2:43913586	Plus	IE	PLEKHH2	acccaccatgaagggattg	62
						ctttgcaaatctgcctgaca
MCF7_RNA_L_13_D07	526	chr6:100,979,123	Minus	E,-	HELIC1	gcagctcctaagggtgagtg
		chr6:101,033,719	Minus			gggattggggtagaggtttt	62
	556	chr6:101,002,220	Plus	U	HELIC1	ttcaatgctgcgattatcctc	62
						tccaattcaatcagggacttc
MCF7_RNA_L_18_F09	630	chr7:128,003,608	Minus	U	CALU	ccaggtaatggcaggttcag
		chr7:128,003,709	Plus			gctggacctatagcaactgaatg	62
	547	chr7:128,005,309	Minus	U	CALU	gaagaagaggaaccggatgg	62
						aagtcttgagcatttcaacagatg
MCF7_RNA_L_23L23	403	chr16:85,490,770	Plus	U	KIAA0182	tattcggcaccacactacc
						agcaaattgtgcaatggaat	62
	405	chr19:16,074,534	Plus	IE	AK023385	ggtttgtgctgaccatctcc	62
						tggatcccaggcattttcta

Key to “Hit type” column: “I”—hit in the intron of a gene, “E”—hit in the exons of a gene; “U”—UTR of a gene, “-”—a hit in intergenic DNA. Since all of these clones were validated using nested primer approach, four primer sequences are reported for each (inner primer set data are given in italics). All PCR products were validated by sequencing.