FIG. 2.

Results of a primer extension (Ext.) analysis to determine the transcriptional initiation site of mucD transcripts from PmucD. Total cellular RNA was isolated (QIAGEN RNeasy) from PAO1 cultures (L broth; OD₆₀₀ of 1.0). A primer (5′ACGATGATCAGAGGTTCGACAAGGCCCG) complementary to the region of DNA 165 bases upstream of the mucD ATG start codon was end labeled with [γ-³²P]ATP (Perkin-Elmer), annealed to 25 μg of RNA, and extended with AMV reverse transcriptase (New England Biolabs). The resulting extension products were loaded onto an 8% polyacrylamide-7 M urea gel. An adjacent sequencing ladder (CTGA) was prepared using a USB Thermo Sequenase ³³P-radiolabeled terminator cycle sequencing kit (USB Corp.) and the same oligonucleotide. Products were revealed by autoradiography. The 5′ end of the extension product for PmucD aligned with a T*, located at −245 bp and within mucC.