TABLE 3.

Sequences and positions of VNTR loci used for MLVA of N. meningitidis

VNTR locus	Size (bp)	Repeat sequence	Detail for N. meningitidis serogroup (GenBank accession no. or strain)
			Serogroup A (NC_003116)			Serogroup B (NC_003112)			Serogroup C (FAM18)a
			Genome coordinates	No. of repeats	Annotated putative function of ORFb	Genome coordinates	No. of repeats	Annotated putative function of ORFb	Genome coordinates	No. of repeats
MLVA
VNTR9-1	9	CCGCTACCC	2052950-2052967	2	Aldose 1-epimerase (mutarotase)	392028-392045	2	Aldose 1-epimerase	1819003-1819047	5
VNTR7-2	7	TTTCCTG	365308-365314	1	Hypothetical protein	2161973-2161993	3	Noncoding	2074902-2074908	1
VNTR7-1	7	TGTTTTC	632208-632228	3	Noncoding	1907366-1907386	3	Noncoding	423366-423379	2
VNTR21-2	21	GCTTCAGTTACAGCTTCTTTG	1603619-1603660	2	Membrane protein	1518309-1518350	2	Hypothetical protein	1407985-1408068	4
VNTR13-1	13	ACGGGAAAATACG	2075417-2075442	2	Noncoding	369378-369403	2	Noncoding	1844470-1844534	5
VNTR3-2	3	GGC	466815-466832	6	Outer membrane peptidase	2061531-2061548	6	Serotype 1-specific antigen	1967113-1967127	5
VNTR6-1	6	TTCATC	1007258-107263	1	ATP-dependent ClpA protease	863513-863536	5	ATP-dependent ClpA protease	793093-793104	3
VNTR4-5	4	GCTT	1658340-1658355	4	Noncoding	1576262-1576281	5	Noncoding	1463466-1463493	7
HV-MLVA
VNTR4-4	4	AAGC	1638926-1638973	12	Noncoding	1556763-1556806	11	Hypothetical protein	1444060-1444091	8
VNTR9-2	9	AAAGTTGCC	2158511-2158555	5	Rotamase	285909-285971	7	Peptidyl-prolyl cis-trans isomerase	277436-277669	26
VNTR4-2	4	AGCC	1494788-1494799	3	Hypothetical protein	1400279-1400358	20	Noncoding	1297888-1297987	25
VNTR4-3	4	GCTT	2123413-2123444	8	Noncoding	321106-321141	9	Noncoding	1892701-1892836	34

^aPreliminary genome sequence from http://www.sanger.ac.uk; no annotation known yet.

^bORF, open reading frame.