TABLE 4.
Sequences and positions of tandem repeat loci not used for MLVA of N. meningitidis
| VNTR locus | Size (bp) | Sequence | Reason for not using VNTR locus in MLVA | Genome coordinatea | Alternate VNTR locus designationb |
|---|---|---|---|---|---|
| VNTR3-1 | 3 | TGC | Low degree of polymorphism, tested on all 92 strains | 1910615 | |
| VNTR4-1 | 4 | GGCA | Low degree of polymorphism, tested on all 92 strains | 1882462 | |
| VNTR4-6 | 4 | AGCA | Several copies of VNTR locus present in genome | 321107 | |
| VNTR4-7 | 4 | AAGG | VNTR locus not present in all test strains | 1994623 | |
| VNTR4-8 | 4 | AAAT | VNTR locus not present in all test strains | 2100218 | |
| VNTR5-1 | 5 | GAAGA | Several copies of VNTR locus present in N. meningitidis serotype B | 455614 | |
| VNTR5-2 | 5 | TTGGG | VNTR locus not present in all test strains | 1273601 | VNTR10 |
| VNTR7-1 | 7 | AAACAAC | Very weak PCR band in N. meningitidis serotype C test strains | 657239 | VNTR01 |
| VNTR7-2 | 7 | ATTTCTC | Not present in all test strains | 773266 | |
| VNTR8-1 | 8 | ATAACAAA | Not present in all test strains | 1437002 | |
| VNTR10-1 | 3 | TAATCCACTA | Polymorphism (deletions) in region flanking locus | 1303221 | VNTR11 |
| VNTR13-1 | 13 | CTGTAGAGATGGG | Several copies of downstream region present in genome | 1131295 | VNTR02 |
| VNTR19-1 | 18 | GGTAATTCCTGACGATTCA | Several copies of VNTR locus present in genome | 1952085 | VNTR04 |
| VNTR19-2 | 19 | CGTCATTCCCACCACTTTT | Several copies of VNTR locus present in genome | 1690479 | |
| VNTR19-3 | 19 | CCGTCATTCCCGCCACTTT | Several copies of VNTR locus present in genome | 1690136 | |
| VNTR21-1 | 21 | GCGTACGGACGTATTCGGCCT | Low degree of polymorphism, tested on all 92 strains | 1425081 | |
| VNTR21-3 | 21 | TTTTTAGATGATGTAAATGTT | Multiple PCR bands, possible PCR artifact | 2228625 |