TABLE 2.
Summary of gain- and loss-of-function GS vector insertion lines and deficiency chromosomes: molecular data and genetic interactions withcut
| Locusa | Cytology | Insertion-site flanking sequenceb | GS vector insertion |
Molecular function/domain structure |
Suppression of ctKc (%) |
Genetic interactions: cut wing allelesd |
|---|---|---|---|---|---|---|
| Gain-of-function GS vector lines | ||||||
| lolae | 47A11-13 | ACGCTTTTTTCCAACGAGAC_ | GS[A916] | Transcription factor/zinc finger/BTB domain |
94 | Group A (ct6, ct53d, ct2s sup.) |
| brat | 37C1-6 | TCCTCTCGAAAGTTCTGCGG_ | GS[A2233] | Transcription factor/B-box zinc finger |
77 | Group A (ct53d sup.) |
| CG14757 | 44B9 | AACTCGAACTCACACCAAAC_ | GS[A2066] | — | 60 | Group A (ct53d sup.) |
| CycE | 35D | AGTGAAGGAAAGAGCGGGAG_ | GS[A1869] | Cyclin-dependent protein kinase regulator |
4 | Group A (ct53d sup.) |
| CG12340d | 47C1 | GTCTTCGTCG _(TTTAAGGG)2CA | GS[A2450] | — | ∼ct rescue | Group B (ct53d enh.) |
| squeeze (sqz) | 91F8-9 | _TGTCGCCCCCAACAAAAGAG | GS[A2967] | Transcription factor/zinc finger | ∼ct rescue | Group B (ct53d enh.) |
| eukaryotic initiation factor 4E (eIF-4E)e | 67B3 | _CGCATACCACACGTTTTCAG | GS[A2783] | Translation initiation factor | 55 | Group B (ct53d enh.) |
| eukaryotic initiation factor 4a (eIF-4a) | 26B2 | _GTTCACACGCTGCGGTAAAA | GS[A2207] | Translation initiation factor/ DEAD-box/helicase |
49 | Group B (ct53d enh.) |
|
Adult enhancer factor 1 (Aef1) |
78D2 | GCCACAGATAATGCTGTGAG_ | GS[A2724] | Transcription factor/zinc finger | 45 | Group B (ct53d enh.) |
| lesswright (lwr) | 21E1 | _AGTGAGACCCTTTGTGTAGA | GS[A2612] | Ubiquitin-like conjugating enzyme |
35 | Group B (ct53d enh.) |
| fusilli (fus) | 52B3-5 | ATAAGCGGCCCACGCACACC_ | GS[A1497] | EGFR-signaling pathway/RNA binding |
22 | Group B (ct53d enh.) |
| posterior sex combs (psc) | 49E6 | _GGCCGAGCCACGACGACACG | GS[A2026] | Chromatin-remodeling/RING finger domain |
16 | Group B (ct53d enh.) |
| CG5390 | 31D1 | _GGCTGAGACTTAAGATTGAA | GS[A2688] | Serine protease | 11 | Group B (ct53d enh.) |
| Sphingomyelin synthase-related (SMSr) | 65F7-9 | _CTCTGAACGGAACAACTGAG | GS[A2330] | Sphingomyelin biosynthesis | 8 | Group B (ct53d enh.) |
| chickadee (chic) | 26A5-B2 | TCAAAATCGGTTTATGGTTC_ | GS[A2665] | Cytoskeleton constituent/actin-binding domain | 7 | Group B (ct6 sup./ct53d enh.) |
| apontic (apt)e | 59F1-4 | ATTGTCATTA_(CTTTTGGC)2CC | GS[A960] | Transcription factor/Myb domain |
∼ct rescue | Group C (ctK sup.) |
| hairy (h) | 66D1 | TATATATAGCGCAACCATCC_ | GS[A1546] | Transcription factor/HLH dimerization domain |
∼ct rescue | Group C (ctK sup.) |
| hephaestus (heph) | 100D3-E1 | _ATCCAGCGGAAAGAGAGCGG | GS[A1768] | Polypyrimidine tract binding | ∼ct rescue | Group C (ctK sup.) |
| CG7752 | 78C4-5 | TCCGTCGAGAACTGCTACAG_ | GS[A1165] | Transcription factor/zinc finger | 61 | Group C (ctK sup.) |
|
G protein α-subunit 65A (G-iα65A) |
65D5 | _ATTCCGGTATTTCCCCCCTT | GS[A2888] | Guanine-nucleotide-binding protein, α-subunit | 37 | Group C (ctK sup.) |
| CG30497 | 43E13-16 | _GCACGGAACGTAGAACGCAG | GS[A1957] | — | 25 | Group C (ctK sup.) |
| CG10373 | 37A1 | CATTGCTTGTTAGTCAGCAC_ | GS[A1703] | Amino acid transport | 25 | Group C (ctK sup.) |
| Ssl1 | 80B2 | _AGCCGGCGCATTTTATTTAG | GS[A1702] | Transcription factor/TFIIH complex |
23 | Group C (ctK sup.) |
| schnurri (shn) | 47D6-E1 | _ACTATAAGTTAGCAAACAAA | GS[A2114] | Transcription factor/zinc finger | 17 | Group C (ctK sup.) |
| CG31782 | 36A10-12 | _GTCCGAAGGCTTATACAGAA | GS[A2197] | Transcription factor | 13 | Group C (ctK sup.) |
| CG1888 | 45F1 | _AATGTCTACATACGCGTACA | GS[A2442] | — | 10 | Group C (ctK sup.) |
| CG7920 | 99D1 | _GGCGAACCAGTTGCAAATTT | GS[A828] | Acetyl-CoA hydrolase/ transferase |
7 | Group C (ctK sup.) |
| regular (rgr) | 44D4 | GTAAGTTAATCACCGCCGCC_ | GS[A1998] | Transcription factor/zincfinger | 6 | Group C (ctK sup.) |
|
Activin like protein at 23B (Alp23B) |
23B1-2 | _GTCTATAGTCATAAATCGAG | GS[A1800] | Signaling ligand/TGFβ-like | 4 | Group C (ctK sup.) |
| anterior open (aop) | 22D1 | GCTCCGCTTTACGGCTGGCA_ | GS[A1685] | Transcription factor/ Et-domain |
4 | Group C (ctK sup.) |
| Serine palmitoyltransferase subunit I (Spt-I) | 49F4 | GATATTTCACGCCTTTTGCC_ | GS[A2040] | Aminotransferase/ pyridoxal 5′-phosphate (PLP)- dependent transferase |
4 | Group C (ctK sup.) |
| trx | 88B1 | _GTTAGAATTTTCGTTTATCT | GS[A2270] | Chromatin-remodeling/PHD domain |
4 | Group C (ctK sup.) |
| 14-3-3ζ | 46E6-8 | GTTAAGTTGTAGGCGCGGAC_ | GS[A2789] | Protein kinase C inhibitor | 4 | Group C (ctK sup.) |
| CG15236 | 42D4-6 | ATGAATGCCAGACCCAGAGC_ | GS[A2203] | – | 4 | Group C (ctK sup.) |
| CG17075 | 21B6-7 | TACGAACCTATAACTGCGCC_ | GS[A1942] | – | 3 | Group C (ctK sup.) |
| Loss-of-function GS vector lines | ||||||
| mor | 89A11 | _GATTCGCCAGTGGCTGCAGA | GS[A897] | Chromatin-remodeling/Myb domain |
79 | Group B (ct53d enh.) |
| Vha68-2 | 34A3 | GAGAAAAGCAGCAATCACAC_ | GS[A1548] | Cation transport | 24 | Group B (ct53d enh.) |
| thioredoxin-2 (Trx-2) | 30C1 | _GATGTGCCAATCGGTCAATC | GS[A866] | Thiol-disulfide exchange intermediate |
40 | Group C (ctK sup.) |
| CG6907 | 25E5 | _GTGTGCCCCCATTGGCAGCC | GS[A945] | — | 28 | Group C (ctK sup.) |
| CG9270 | 38F6 | _CCTCGGGCACTCCGTAAACG | GS[A839] | ABC transporter | 16 | Group C (ctK sup.) |
| mitochondrial ribosomal protein L4 (mRpL4) | 35F11 | ACATTTTTCG_(TGTCACGG)2TG | GS[A961] | Mitochondrial large ribosomal subunit |
14 | Group C (ctK sup.) |
| stathmin (stai) | 26B9 | AAGCCCAGCTGGTGCTCACC_ | GS[A1533] | Microtubule-associated protein | 8 | Group C (ctK sup.) |
| Deficiency chromosomes | ||||||
| Df(2L)Prl | 32F-3; 33R1-2 |
100 | ND | |||
| Df(3L)Cat | 75C1-2; 75F1 |
100 | ND | |||
| Df(3R)p25, Df(3R)P2 | 85A3; 85B1, 89D9-E1; 89E2-3 |
100 | ND | |||
ND, not determined.
a
Gene or predicted gene located closest to the insertion site and positioned in the 5′–3′ orientation relative to the GS vector.
b
Genomic sequence of the coding strand (5′–3′ orientation) flanking the site of GS vector insertion (underscore).
c
GS insertion lines were crossed to ctK; C96-Gal4 females. Male progeny of the genotype ctK/Y; GS[*]/C96-Gal4 were scored. The percentage of suppression is equal to the number of wings displaying a complete suppression of ctK-associated gaps in the anterior margin sensory bristles divided by the total number of wings scored. Cases in which ctK suppression resembled the dominant phenotype resulting from the overexpression of Cut are represented by “∼cut rescue.” The suppression of ctK for all GS vector insertion lines is significant (P ≤ 0.01). Less than 1.0% of negative control males (ctK/Y; UAS-lacZ/C96-Gal4) were suppressed.
d
Genetic interactions with cut wing alleles ct6 (gypsy), ct53d (non-gypsy), and ct2s (non-gypsy) are summaried.
e
Multiple unique GS vector insertions were identified within locus.