Skip to main content
. 2006 May;74(5):2637–2650. doi: 10.1128/IAI.74.5.2637-2650.2006

TABLE 1.

Primers used in this study

Primer Sequence 5′→3′ Amplification target
Northern blot probe PCR
    Sta2 For GCGTATGTTCAATTTGTCG 1,140-bp product from lst of N. gonorrhoeae and N. meningitidis
    Sta3 Rev CGTCAAATGTCAAAATCGG
Real-time PCR
    LstRTF AAACCCGCATACGAGGTATGA 100-bp product from lst of N. gonorrhoeae and N. meningitidis
    LstRTR AAGCCGGTTTCAATGCGTAA
    16S RT F GCGTGGGTAGCAAACAGGAT 100-bp product from rrs gene of N. gonorrhoeae and N. meningitidis
    16S RT R CGCGTTAGCTACGCTACCAAG
Cloninga
    FusBam F1 CGCTGGATCCGACATCAATATCGG 496 bp of N. gonorrhoeae 5′lst including RBS sequence and 24 bp of lst including ATG
    FusBam R1 CAAAGGATCCTTTTTCAAGCCC 586 bp of N. meningitidis 5′lst including RBS sequence and 24 bp of lst including ATG
Primer extension
    PE1 CGCATTCCTTTCCCCCTGATTTAC 3′ region of primers anneals 78, 16, and 24 bp downstream of lst ATG, respectively
    PE2 CACAACACGGTCAAACAAGC
    PE3 CAATCAGGCACAACACGGTC
RPA primers
    PA1 GATCGAGCTCGTTCGATCTTGGCGTGTTTG 292 bp of N. gonorrhoeae 5′lst excluding the RBS sequence; SacI site of PA1 is denoted by double underline
    PA2 GATCGGATCCCTCCATTCCGACAAATTGAAC
    PA3 AATTAACCCTCACTAAAGGG 397-bp product from pSKII including the cloned 292-bp N. gonorrhoeae 5′lst insert
    PA4 GTAATACGACTCACTATAGGG
RT-PCR: Fig. 7
    P1 CGGGATCCGGCTTTCCCGCGTTTGCCGG 5′ region of the primer anneals upstream of CREE; 282 bp upstream of lst ATG
    P2 CGGGATCCCGCCTTGTGCCTGATGTGCG 5′ region of the primer anneals upstream of CREE; 252 bp upstream of lst ATG
    P3 CGGGATCCTTTCGGTAAAATTGATTTTA 5′ region of the primer anneals upstream of CREE; 222 bp upstream of lst ATG
    P4 CGGGATCCAACTGTCGGAATATCTGCTA 5′ region of the primer anneals downstream of CREE; 91 bp upstream of lst ATG
    P5 CGGGATCCTTTTTCCGTCCCGGGACAC 5′ region of the primer anneals downstream of CREE; 61 bp upstream of lst ATG
    P6 CGGGATCCACACTCGGGGCGTATGTTCA 5′ region of the primer anneals downstream of CREE; 41 bp upstream of lst ATG
    P7 CGGGATCCAGGGATATGGGCTTGAAAAAG 5′ region of the primer anneals downstream of CREE; 6 bp upstream of lst ATG
    Crev CTCCGCCATCGTCGGAAT Common reverse primer used in conjunction with primers P1 to P7 and the 3′ region of the primer anneals 372 bp downstream of lst ATG
RT-PCR: Fig. 8
    IP1 TTATTCTCTCTTGTAGGTTGG Generates a 212-bp product of 5′icd upstream region; P4 and Crev primers used in Fig. 7 were used in Fig. 8
    IP2 TGCCGCCGCACATCAGGCACA
a

Primers FusBam F1 and FusBam R1 were used to include regions of the N. gonorrhoeae or N. meningitidis 5′lst region including the RBS and 24 bp of the lst gene including ATG to create translational lacZ fusions in pLES94. The BamHI restriction sites are underlined with single lines.