Abstract
In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.
Full Text
The Full Text of this article is available as a PDF (82.9 KB).
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Broccoli D., Young J. W., de Lange T. Telomerase activity in normal and malignant hematopoietic cells. Proc Natl Acad Sci U S A. 1995 Sep 26;92(20):9082–9086. doi: 10.1073/pnas.92.20.9082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cardenas M. E., Bianchi A., de Lange T. A Xenopus egg factor with DNA-binding properties characteristic of terminus-specific telomeric proteins. Genes Dev. 1993 May;7(5):883–894. doi: 10.1101/gad.7.5.883. [DOI] [PubMed] [Google Scholar]
- Chong L., van Steensel B., Broccoli D., Erdjument-Bromage H., Hanish J., Tempst P., de Lange T. A human telomeric protein. Science. 1995 Dec 8;270(5242):1663–1667. doi: 10.1126/science.270.5242.1663. [DOI] [PubMed] [Google Scholar]
- Coren J. S., Epstein E. M., Vogt V. M. Characterization of a telomere-binding protein from Physarum polycephalum. Mol Cell Biol. 1991 Apr;11(4):2282–2290. doi: 10.1128/mcb.11.4.2282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Counter C. M., Hirte H. W., Bacchetti S., Harley C. B. Telomerase activity in human ovarian carcinoma. Proc Natl Acad Sci U S A. 1994 Apr 12;91(8):2900–2904. doi: 10.1073/pnas.91.8.2900. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dignam J. D., Lebovitz R. M., Roeder R. G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983 Mar 11;11(5):1475–1489. doi: 10.1093/nar/11.5.1475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Giraldo R., Rhodes D. The yeast telomere-binding protein RAP1 binds to and promotes the formation of DNA quadruplexes in telomeric DNA. EMBO J. 1994 May 15;13(10):2411–2420. doi: 10.1002/j.1460-2075.1994.tb06526.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Giraldo R., Suzuki M., Chapman L., Rhodes D. Promotion of parallel DNA quadruplexes by a yeast telomere binding protein: a circular dichroism study. Proc Natl Acad Sci U S A. 1994 Aug 2;91(16):7658–7662. doi: 10.1073/pnas.91.16.7658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Greider C. W., Blackburn E. H. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell. 1985 Dec;43(2 Pt 1):405–413. doi: 10.1016/0092-8674(85)90170-9. [DOI] [PubMed] [Google Scholar]
- Gualberto A., Patrick R. M., Walsh K. Nucleic acid specificity of a vertebrate telomere-binding protein: evidence for G-G base pair recognition at the core-binding site. Genes Dev. 1992 May;6(5):815–824. doi: 10.1101/gad.6.5.815. [DOI] [PubMed] [Google Scholar]
- Ishikawa F., Matunis M. J., Dreyfuss G., Cech T. R. Nuclear proteins that bind the pre-mRNA 3' splice site sequence r(UUAG/G) and the human telomeric DNA sequence d(TTAGGG)n. Mol Cell Biol. 1993 Jul;13(7):4301–4310. doi: 10.1128/mcb.13.7.4301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kang C., Zhang X., Ratliff R., Moyzis R., Rich A. Crystal structure of four-stranded Oxytricha telomeric DNA. Nature. 1992 Mar 12;356(6365):126–131. doi: 10.1038/356126a0. [DOI] [PubMed] [Google Scholar]
- Kim N. W., Piatyszek M. A., Prowse K. R., Harley C. B., West M. D., Ho P. L., Coviello G. M., Wright W. E., Weinrich S. L., Shay J. W. Specific association of human telomerase activity with immortal cells and cancer. Science. 1994 Dec 23;266(5193):2011–2015. doi: 10.1126/science.7605428. [DOI] [PubMed] [Google Scholar]
- Leroy J. L., Guéron M., Mergny J. L., Hélène C. Intramolecular folding of a fragment of the cytosine-rich strand of telomeric DNA into an i-motif. Nucleic Acids Res. 1994 May 11;22(9):1600–1606. doi: 10.1093/nar/22.9.1600. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morin G. B. The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell. 1989 Nov 3;59(3):521–529. doi: 10.1016/0092-8674(89)90035-4. [DOI] [PubMed] [Google Scholar]
- Petracek M. E., Konkel L. M., Kable M. L., Berman J. A Chlamydomonas protein that binds single-stranded G-strand telomere DNA. EMBO J. 1994 Aug 1;13(15):3648–3658. doi: 10.1002/j.1460-2075.1994.tb06672.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Price C. M. Telomere structure in Euplotes crassus: characterization of DNA-protein interactions and isolation of a telomere-binding protein. Mol Cell Biol. 1990 Jul;10(7):3421–3431. doi: 10.1128/mcb.10.7.3421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Raghuraman M. K., Cech T. R. Assembly and self-association of oxytricha telomeric nucleoprotein complexes. Cell. 1989 Nov 17;59(4):719–728. doi: 10.1016/0092-8674(89)90018-4. [DOI] [PubMed] [Google Scholar]
- Schierer T., Henderson E. A protein from Tetrahymena thermophila that specifically binds parallel-stranded G4-DNA. Biochemistry. 1994 Mar 1;33(8):2240–2246. doi: 10.1021/bi00174a034. [DOI] [PubMed] [Google Scholar]
- Schultze P., Smith F. W., Feigon J. Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG). Structure. 1994 Mar 15;2(3):221–233. doi: 10.1016/s0969-2126(00)00023-x. [DOI] [PubMed] [Google Scholar]
- Sheng H., Hou Z., Schierer T., Dobbs D. L., Henderson E. Identification and characterization of a putative telomere end-binding protein from Tetrahymena thermophila. Mol Cell Biol. 1995 Mar;15(3):1144–1153. doi: 10.1128/mcb.15.3.1144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sundquist W. I., Klug A. Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loops. Nature. 1989 Dec 14;342(6251):825–829. doi: 10.1038/342825a0. [DOI] [PubMed] [Google Scholar]
- Tommerup H., Dousmanis A., de Lange T. Unusual chromatin in human telomeres. Mol Cell Biol. 1994 Sep;14(9):5777–5785. doi: 10.1128/mcb.14.9.5777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weisman-Shomer P., Fry M. QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA. J Biol Chem. 1993 Feb 15;268(5):3306–3312. [PubMed] [Google Scholar]
- Williamson J. R., Raghuraman M. K., Cech T. R. Monovalent cation-induced structure of telomeric DNA: the G-quartet model. Cell. 1989 Dec 1;59(5):871–880. doi: 10.1016/0092-8674(89)90610-7. [DOI] [PubMed] [Google Scholar]
- Zhong Z., Shiue L., Kaplan S., de Lange T. A mammalian factor that binds telomeric TTAGGG repeats in vitro. Mol Cell Biol. 1992 Nov;12(11):4834–4843. doi: 10.1128/mcb.12.11.4834. [DOI] [PMC free article] [PubMed] [Google Scholar]
