Table 1.
Nucleotide sequence variation at sites that vary among ancient Australian, the Feldhofer, and the Insert sequences
| Nucleotide site
|
|
|---|---|
| 111111111111111222222222222222222222222222233333333333333 | |
| 79001122345668889001223344444555566677888899901112345556688 | |
| 83781269984393499198340413479368923448467803911780715672817 | |
| CRS | ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA |
| Bonobo | ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC.. |
| Chimpanzee | ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C.. |
| Feldhofer | GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C... |
| Insert | -......A.......AA..T..G.....C...A.CTATG..CTC.TC.....TC..C.. |
| LM3 | ....................T.G...........CT.T....T..T......TC....G |
| LM4 | .................T...........G................C............ |
| LM15 | ....................T........................T.......C....G |
| LM55 | ...........G.......................T....................... |
| KS1 | .C............T.....T.........................CG..T........ |
| KS7 | ..............T.....T..................T...........C....... |
| KS8 | ....................T.G..............TG.......C............ |
| KS9 | .C..................T..............T............C.........G |
| KS13 | .C............T.....T....C.G.................TC............ |
| KS16 | ....................T...................T.............C..C. |
| Aboriginal | TG CT TCC A CA TCG C C A T CC CT T |
| Polymorphism | CA TC CTT T TC CTA T T G C TT TC C |
| GJA | .....................C........................C............ |
| AT | ......C.................................................... |
| Contaminant | .....................C........................C............ |
| K13 Cntmnt | -------.............T.........................------------- |
Nucleotide sites are numbered as in the CRS less 16,000 (50), so that, for example, our site 78 corresponds to site 16,078 in the CRS. Variation in living Aboriginal Australians is shown for individual sites rather than as continuous linear sequences. The following additional sites are variable in samples from living Aboriginal Australians (41): 51, 72, 75, 86, 137, 158, 172, 176, 179, 188, 192, 193, 213, 221, 239, 245, 260, 261, 266, 270, 271, 291, 294, 295, 303, 304, 319. Only differences from the CRS are shown. Information about the bone samples is in refs. 48 and 52, and references therein. GJA, Greg J. Adcock; AT, Alan Thorne.