Table 1.
Ancestor | ggga+cccgggccgggcccccgacggggtaagctaggggcgt |
---|---|
3P | a......t........t........a..........a..... |
1U | .a..........a..a...................a...... |
1J | ..c...........aa...................a...... |
3B+4J | ..c............a...................a...... |
1P | ........ca.t.........a....a....at......... |
1P | .............a.a...t...a...........a...... |
1J | ...............a.................c.a...... |
1U | ...............a...................a..a... |
2P | ...............a...................a....c. |
1K | ...............a...................a.....c |
13B+11J+14U+8K+2P | ..............a...................a...... |
1U | ...............a...................a...t.. |
1B+2UK | ...............a..................ca...... |
1J | ...............a...........t.......a...... |
1B+1K | ...............a......c............a...... |
1B+2J+4K+4P | ...............a....t..............a...... |
1P | ...............a...t...a...........a.a.... |
2K | ...............a...t...a...........a...... |
1K | ...............a..t................a...... |
1P+1K | .......................................... |
1U | ..........t....a..................ca...... |
1B | .......t.................................. |
1P | .....t...........t........a.acg........... |
3P | ....−..t................a................. |
1P | ....−.gt................a................. |
2K | ...g......................a....a.......... |
Dots represent the same state as in the ancestor sequence. + and − in polymorphism number 5 represent presence or absence of a 5-bp motif, respectively. Abbreviations: B (Basques), J (Japanese), K (Kenyans), P (pygmies) and U (U.K.).