Table 1.
Sequences of primers and conditions used for semiquantitative RT-PCR
| Target mRNA | Sequence (5′→3′) | Annealing temperature | Amplification cycles | GenBank accession no. | Product size (bp) | |
|---|---|---|---|---|---|---|
| NaV 1.1 | (S) | gcattgcagaagaaaaagctaagaa | 49°C | 30 | NM_030875 | 403 |
| (A) | cctgtgaaggtgtactctacatt | (Rat) | ||||
| NaV 1.2 | (S) | gatgacgataacgaaatgaacaac | 44°C | 32 | X03639 | 570 |
| (A) | tatctgacaacacttgaactt | (Rat) | ||||
| NaV 1.3 | (S) | agggaaggattgacttgcc | 47°C | 37 | Y00766 | 295 |
| A | tggacctctccttagagtcca | (Rat) | ||||
| NaV 1.6 | (S) | cgagagctatctggagaacggcca | 55°C | 30 | NM_019266 | 440 |
| (A) | gcctcctcctgctgcttctt | (Rat) | ||||
| Kir 6.2 | (S) | caccctgcgccatggccgcc | 53°C | 30 | NM_031358 | 173 |
| (A) | ttaccacccacaccgttctc | (Rat) | ||||
| SUR 1 | (S) | taytggtggatgaaygcctt | 53°C | 33 | AB052294 | 752 |
| (A) | cttrgtrcsacraartactg | (Rat) | ||||
| TREK-1 | (S) | tcaagcacatagaaggctgg | 55°C | 33 | AF325671 | 434 |
| (A) | tcaggtggttcacagacagg | (Rat) | ||||
| TRAAK | (S) | gggcagcgccttctttttct | 55°C | 32 | AF302842 | 440 |
| (A) | ccagaaccacaccagcggct | (Rat) | ||||
| 18S-rRNA | (S) | tcaagaacgaaagtcggagg | 54°C | 17 | BK000964 | 494 |
| (A) | ggacatctaagggcatcaca | (Mouse) |
S, sense; A, antisense. For all of the reactions, preliminary experiments were performed to determine the number of PCR cycles at which saturation occurred. The experiments were carried out with the number of cycles that precedes saturation as indicated in the table.