Table 1.
VNTR locus characteristics at genomes of N. meningitidis strains Z2491, MC58 and FAM18.
| VNTR locusa | Consensus sequence(s) of repeat unitb | Length of repeat unit (bp) | Locus in Z2491 | Locus in MC58 | Locus in FAM18 | Function (Reference or locus_tagc) | |||
| Location | Number of repeat unit | Location | Number of repeat unit | Location | Number of repeat unit | ||||
| NMTR1 (VNTR01) | CAAACAA | 7 | 814844–815018 | 25 | 657240 – 657484 | 35 | 601072 – 601274 | 29 | glycosyl transferase [23] |
| NMTR2 | CATTTCT | 7 | 920757 – 920875 | 17 | 773274 – 773301 | 4 | 716022 – 716154 | 19 | Unknown |
| NMTR6 | GCTTCAGTTACAGCTTCTTTG | 21 | 1603619 – 1603660 | 2 | 1518318 – 1518359 | 2 | 1407985 – 1408068 | 4 | membrane protein (NMA1680) |
| NMTR7 | CAAG | 4 | 1638925 – 1638972 | 12 | 1556771 – 1556814 | 11 | 1444059 – 1444090 | 8 | hypothetical protein (NMB1507) |
| NMTR9 (VNTR06 & VNTR08) | GCCAAAGTT | 9 | 2158594 – 2158514 | 9 | 285906 – 285968 | 7 | 277433 – 277666 | 26 | rotamase (NMA2206) |
| NMTR9a | CCGCTGCTACTGCCGCTGCTGAAGCACCTG | 30 | 1100635 – 1100694 | 2 | 970825 – 970854 | 1 | 932818 – 932907 | 3 | dihydrolipoamide succinyltransferase E2 component (NMA1150) |
| NMTR9b | TACGGCTGCCGCGTCAAA | 18 | 1385171 – 1385206 | 2 | 1293181 – 1293216 | 2 | 1191565 – 1191582 | 1 | murein hydrolase (NMA1488) |
| NMTR9c | CGGATACGCTCTTGG | 15 | 1446130 – 1446174 | 3 | 1353481 – 1353510 | 2 | 1250095 – 1250139 | 3 | hypothetical protein (NMA1547) |
| NMTR10 | CAGATT | 6 | 2058538 – 2058515 | 4 | 386427 – 386480 | 9 | 1824619 – 1824596 | 4 | DNA-directed RNA polymerase-β-chain (NMA0141) |
| NMTR12 (VNTR02) | a:GGGCTGTAGAGAT b: GGCTGTAGAGAT | 13, 12 | 1234098 – 1234135 | 3 = 2a1b | 1131164 – 1311531 | 29 = 20a9b | 1043723 – 1044023 | 24 = 13a11b | Unknown |
| NMTR18 | GGGTAGCGG | 9 | 2052950 – 2052967 | 2 | 392028 – 392045 | 2 | 1819003 – 1819047 | 5 | aldose 1-epimerase (NMA2099) |
| NMTR19 | CGTATTTTCCCAT | 13 | 2075417 – 2075442 | 2 | 369378 – 369403 | 2 | 1844470 – 1844534 | 5 | Unknown |
a Loci in parentheses have previouslybeen characterized by Yazdankhah et al.[20]
bNMTR12 is a compound tandem repeat locus with 12- and 13-bp repeat units, arranged in variable numbers and sequences.
cLocus tag in parentheses are based on gene annotation of N. meningitidis strain Z2491 (GenBank accession no. AL157959), except the NMTR7 locus, which is based on gene annotation of strain MC58 (GenBank accession no. AE002098).