Skip to main content
RNA logoLink to RNA
. 2006 Jul;12(7):1161–1167. doi: 10.1261/rna.2322506

Post-transcriptional regulation of microRNA expression

Gregor Obernosterer 1,3, Philipp JF Leuschner 1,3, Mattias Alenius 2,3, Javier Martinez 1
PMCID: PMC1484437  PMID: 16738409

Abstract

microRNAs (miRNAs) are endogenous, noncoding ∼22-nucleotide RNA molecules that have recently emerged as fundamental, post-transcriptional regulators of cognate target gene expression. Many mammalian miRNAs are expressed in a tissue-specific manner, a phenomenon that has so far been attributed to transcriptional regulation. We here show by Northern blots and in situ hybridization experiments that the expression of mammalian miRNAs can be regulated at the post-transcriptional level. In particular, miR-138 is spatially restricted to distinct cell types, while its precursor, pre-miR-138-2, is ubiquitously expressed throughout all tissues analyzed. Furthermore, pre-miR-138-2 is exported from the nucleus to the cytoplasm, suggesting that cleavage of this pre-miRNA by Dicer is restricted to certain tissues and cell types. Thus, differential processing of pre-miRNAs might be an alternative mechanism to control miRNA function.

Keywords: microRNAs, post-transcriptional regulation, Dicer, tissue-specific expression

INTRODUCTION

miRNAs are a family of small (∼22 nucleotides [nt]), endogenous, noncoding RNAs that, by binding complementary sequences in the 3′ untranslated region (3′ UTR) of messenger RNAs (mRNAs), either mediate translational repression or direct mRNA cleavage (Pillai 2005). miRNAs are transcribed as mono- or polycistronic, long, primary precursor transcripts (pri-miRNAs) that are cleaved into ∼70-nt precursor hairpins, known as pre-miRNAs, by the nuclear RNase III-like enzyme Drosha (Lee et al. 2003). Subsequently, pre-miRNA hairpins are exported to the cytoplasm by Exportin-5 (Yi et al. 2003; Bohnsack et al. 2004; Lund et al. 2004), where they are processed by a second RNase III-like enzyme, termed Dicer, into ∼22-nt duplexes (Bernstein et al. 2001; Hutvágner et al. 2001; Ketting et al. 2001; Knight & Bass 2001), followed by the asymmetric assembly of one of the two strands into a functional miRNP or miRISC (Khvorova et al. 2003; Schwarz et al. 2003).

More than 800 miRNAs have so far been experimentally discovered in mammals (Lagos-Quintana et al. 2001, 2002; Bentwich et al. 2005) and some of them are highly conserved between invertebrates and vertebrates (Bartel 2004). However, through the development of increasingly sophisticated algorithms based on machine learning techniques, the number of predicted miRNAs currently amounts to a few thousand (Lim et al. 2003; Bentwich et al. 2005; Berezikov et al. 2005). Many mammalian miRNAs are tissue- and/or developmental stage-specifically expressed. Several microarray profiling studies have shown that the expression pattern of a large number of miRNAs can be attributed to regulatory sequences present in their promoters (Babak et al. 2004; Barad et al. 2004; Calin et al. 2004; Liu et al. 2004; Miska et al. 2004; Sempere et al. 2004). Furthermore, host genes harboring miRNA sequences in their intronic sites impose their pattern of expression to the respective miRNAs (Bartel 2004; Rodriguez et al. 2004).

The current view suggests that miRNA expression is mainly controlled at the transcriptional level. For example, the transcription factors MyoD, Mef2, and SRF determine the heart-specific expression of miR-1 (Zhao et al. 2005). A recent study by O'Donnell and colleagues (O'Donnell et al. 2005) shows that the proto-oncogene c-Myc activates the expression of the miR-17-92 cluster. However, like other RNAs, miRNA expression could potentially be controlled at the post-transcriptional level (Pillai 2005). It has been shown in Caenorhabditis elegans that miR-38 is regulated in a temporal manner by differential maturation of pre-miR-38 during development (Ambros et al. 2003). We here provide conclusive evidence that also mammalian miRNA expression can be regulated at the level of miRNA processing.

RESULTS AND DISCUSSION

As a first step in validating targets of a set of brain-specific miRNAs, we isolated total RNA from brain and other mouse tissues, as well as from HeLa cells, and performed Northern blots with miRNA-specific probes. As expected for miR-138, the mature ∼23-nt miRNA was detectable only in brain tissue (Fig. 1A). In particular, we found that miR-138 was expressed in the cerebrum, the cerebellum, and the midbrain of adult mice as well as in the murine neuroblastoma cell line N2A (Fig. 1B). Strikingly, its putative ∼69-nt precursor was present in all tissues and cells analyzed (Fig. 1A, left panel; 1B), suggesting that the ubiquitously expressed precursor is processed into the mature miRNA in a tissue-specific manner.

FIGURE 1.

FIGURE 1.

(A) Northern blot analysis of different brain-specific miRNAs. Thirty micrograms of total RNA from HeLa cells and from different mouse tissues were blotted and probed with a 5′-radiolabeled, LNA-modified oligodeoxynucleotide complementary to the indicated miRNAs. Equal loading of total RNA on the gel was verified by hybridizing with a probe complementary to the U6 snRNA. Note that only the precursor of miR-138 displays a ubiquitous pattern. The asterisk highlights the faint band of pre-miR-124a seen in the lane of murine brain at ∼57 nt. (B) Northern blot analysis of total RNA isolated from HeLa cells, from the murine neuroblastoma cell line N2A, and from different neuronal tissues of murine brain showing the tissue-specific processing of the ubiquitous 69-nt pre-miRNA. The band at 69 nt corresponds to the precursor, which is present in all cells and tissues that were analyzed. The 23- to 24-nt bands represent the mature miR-138, which is specifically expressed in the cerebrum as well as in the cerebellum, midbrain, and N2A cells, albeit to a lower extent. (C) Northern blot analysis of pre-miR-138-2 and pre-miR-138-1. One hundred micrograms of total RNA from murine brain were blotted and probed with 5′-radiolabeled, LNA-modified oligonucleotide probes complementary to the mature sequence of miR-138 (m), to the terminal loop of pre-miR-138-2 (p2), and to the terminal loop of pre-miR-138-1 (p1).

Two putative precursors were recently predicted for miR-138, termed “pre-miR-138-1” and “pre-miR-138-2,” which are encoded on different chromosomal loci and are 62 nt and 69 nt in size, respectively (Lagos-Quintana et al. 2002; Griffiths-Jones 2004; Weber 2005). Multiple sequence alignments (Schwartz et al. 2000) of the two chromosomal regions showed high conservation of the mature miRNA among different vertebrate species, whereas only the locus of miR-138-2 showed an overall conservation pattern in the flanking sequences (Supplemental Material).

To check that (1) the ∼69-nt band is indeed a precursor miRNA and, if so, (2) which of the two precursors is ubiquitously expressed, we performed Northern blots with total RNA isolated from HeLa cells and probed against the mature sequence as well as sequences specific for the loop regions of the two different precursors. Interestingly, the probe against the mature miR-138 showed a single band at 69 nt, which was also revealed by a probe against the loop region of pre-miR-138-2 (Fig. 1C). Mismatches in the probes against the sequences of the mature miR-138 and of pre-miR-138-2 abolished detection of the 69-nt band (Supplemental Material), indicating that the ubiquitously expressed ∼69-nt band shown in Figure 1, A and B, is indeed a precursor of miR-138, and that the mature miR-138 derives from pre-miR-138-2. In agreement with this, we were not able to detect a 62-nt band that would correspond to pre-miR-138-1 (Fig. 1C) either with a mature probe or with a probe against the loop region of pre-miR-138-1.

To further investigate the overall distribution of miR-138 and its precursor, we performed in situ hybridizations with 3′ DIG-labeled LNA oligonucleotide probes on cryo-sections of E17 mouse embryos (Fig. 2A) and adult brain (Fig. 2B). We observed a strong staining in the central nervous system (CNS) for mature miR-138 (Fig. 2A, left panel). In particular, miR-138 was primarily localized to most neurons in the hippocampus and to specific regions of the neocortex, but also to the cerebellum (Fig. 2A, left panel; 2B, upper panel). This clearly demonstrates that expression of miR-138 is not uniform throughout the brain but restricted to distinct neuronal populations. Surprisingly, miR-138 was also expressed in fetal liver (Fig. 2A, left panel; 2C) but not in adult liver (Fig. 2C), indicating that the expression of miR-138 is also developmentally regulated. To confirm the ubiquitous expression observed for pre-miR-138-2 in Northern blots performed with total RNA from adult tissues, we prepared a probe recognizing the loop region of the pre-miR-138-2 hairpin. Like Northern blots, in situ hybridizations showed a broad expression of pre-miR-138-2 in most organs of the embryo (Fig. 2A, right panel) as well as in adult brain (Fig. 2B, lower panel). To summarize, these data (Northern blots and in situ hybridizations) suggest that pre-miR-138-2 processing is both temporally and spatially regulated.

FIGURE 2.

FIGURE 2.

(A) In situ hybridization experiment on cryo-sections of E17 mouse embryos using LNA-modified probes that recognize mature miR-138 (left panel) or pre-miR-138-2 (right panel). The probe against mature miR-138 shows a strong expression in neuronal tissues (brain, CNS) and also in fetal liver, while the probe hybridizing to pre-miR-138-2 gives a strong signal in almost all tissues of the embryo. The seemingly low level of pre-miR-138-2 in brain can be explained by a low cellular density of the brain region as well as to a short exposure time used to prevent overexposure of tissues with higher cellular density. Magnifications of the fetal brain region can be seen in the Supplemental Material, where exposure time has been optimized to visualize expression of both mature miR-138 and pre-miR-138-2. (B) In situ hybridization experiments on cryo-sections of adult mouse brain using LNA-modified oligonucleotide probes that recognize mature miR-138 (upper panel) or pre-miR-138-2 (lower panel). miR-138 is primarily located to specific regions of the neocortex, most neurons in the hippocampus, and granule and purkinje cells of the cerebellum, while pre-miR-138-2 is essentially uniformly distributed. Magnifications of the cerebellum can be seen in the Supplemental Material. (C) Northern blot analysis of miR-138 expression in fetal and adult brain and liver. One hundred micrograms of total RNA prepared from the indicated tissues were blotted and probed for miR-138. In the mouse embryo, miR-138 is expressed in both brain and liver, which is in agreement with the findings in the in situ hybridization experiments. In the adult, miR-138 is restricted to brain. (D) Northern blot of total HeLa RNA and cytoplasmic and nuclear RNA fractions from HeLa cells probed against pre-miR-138-2. The band at 69 nt corresponds to pre-miR-138-2 that is mainly found in the cytoplasmic fraction, indicating nuclear export of the precursor.

How is this differential processing achieved? A tempting hypothesis is that the export of pre-miR-138-2 is impaired in all tissues except brain, thus preventing cleavage by Dicer in the cytoplasm. To evaluate this possibility, we isolated cytoplasmic and nuclear RNA from HeLa cells, where pre-miR-138-2 is not processed, and examined its subcellular distribution. Northern blot analysis showed that the precursor is effectively exported to the cytoplasm (Fig. 2D), indicating that cleavage by Dicer could be the regulated step.

We envision that tissue-specific expression could be achieved either by an activator present in tissues that express miR-138 or, alternatively, by an inhibitor acting on tissues that lack expression of miR-138. We were able to show that recombinant Dicer enzyme is able to convert pre-miR-138-2 into mature miR-138, a result that rules out the activator model (Fig. 3A). Thus, we favor the presence of an inhibitory factor, which binds pre-miR-138-2 and prevents its conversion into a mature miR-138 by Dicer in all tissues not expressing miR-138. This hypothesis is fostered by in vitro experiments, where the addition of increasing amounts of HeLa cytoplasmic extracts readily abolished processing of pre-miR-138-2 by recombinant Dicer (Fig. 3B). Importantly, processing of pre-miR-19a, a miRNA that is normally expressed in HeLa cells (Lagos-Quintana et al. 2001), was not abolished by titrating increasing amounts of HeLa cytoplasmic extracts (Fig. 3C). We further analyzed pre-miRNA processing in living cells. For this purpose, we transfected HeLa cells transiently with plasmids encoding either pre-miR-124a or pre-miR-138-2 under the control of the H1 promoter. Northern blots showed that pre-miR-124a was converted into the mature miR-124a, whereas pre-miR-138-2 was not processed (Fig. 3D,E). This suggests that HeLa cells, and possibly all other tissues and cells that do not express miR-138, may contain a factor that specifically recognizes pre-miR-138-2 and inhibits its processing by Dicer. Thus, tissues and cells that do express miR-138 may lack this factor or may render it inactive, allowing Dicer cleavage to occur (Fig. 4).

FIGURE 3.

FIGURE 3.

(A) Processing reaction of pre-miR-138-2 into mature miR-138 by recombinant Dicer (rDcr) resolved on a 15% denaturing PAGE. (B) As in A. The addition of increasing amounts of HeLa cytoplasmic extract effectively abolishes the processing of pre-miR-138-2. The band corresponding to the respective pre-miRNA is indicated by “pre,” whereas the band representing the mature miRNA is designated by “m.” (C) Processing of pre-miR-19a into mature miR-19a is not abolished by addition of increasing amounts of HeLa cytoplasmic extract. The efficiency of processing is reduced by the addition of HeLa cytoplasmic extracts; however, the level of processing does not decrease with higher amounts of HeLa cytoplasmic extracts. (D) HeLa cells were transfected with the indicated amounts of a plasmid encoding the sequence of pre-miR-124a. The conversion of pre-miR-124a into mature miR-124a was monitored by Northern blotting. (E) HeLa cells were transfected with the indicated amounts of a plasmid encoding the sequence of pre-miR-138-2. In contrast to pre-miR-124a, HeLa cells failed to process pre-miR-138-2 into mature miR-138. Note that pre-miR-138-2 is more abundant than pre-miR-124a.

FIGURE 4.

FIGURE 4.

Model depicting how differential processing of an otherwise ubiquitously expressed pre-miRNA mediates tissue- and/or developmental stage-specific expression of the mature miRNA. In both tissues, expressing or not expressing the mature miR-138, its gene is transcribed into pri-miR-138-2, which is cleaved in the nucleus by Drosha into pre-miR-138-2 and then exported to the cytoplasm. Here, the presence or the absence of an inhibitory factor determines whether pre-miR-138-2 becomes processed or not, thus leading to differential expression of mature miR-138.

In this report we demonstrate that differential processing of precursor miRNAs into mature miRNAs leads to tissue- and developmental-specific miRNA expression in mammals. The presence of an unprocessed miRNA precursor in most tissues of the organism is intriguing. It could be envisioned that the unprocessed precursor might play a different role in the cell, irrespective of the function of the mature miRNA. This novel mechanism could be a more general feature for the regulation of miRNA expression. Obviously, we are left with the question of why cells employ such a complex and energy wasteful method of restricting the function of one particular miRNA to certain cellular populations. Clearly, such regulation allows higher expression stringency, but also an opportunity for quick regulation. The precursor form of the functional miRNA is already expressed, and the cells can quickly produce the mature miRNA by modifying the regulator. This could be very important for fast responses like coupling neuronal processes in time, like LTP gene expression.

MATERIALS AND METHODS

Isolation of total RNA from cells, mouse tissues, and Northern blotting

Isolation of total RNA from cultured cells or tissues and subsequent Northern blotting was performed as previously described (Lagos-Quintana et al. 2001). Twenty micrograms of total RNA were separated in a 15% polyacrylamide gel (20 × 25 cm) containing 8 M urea (SEQUAGEL, National Diagnostics), transferred to a Hybond-N+ membrane (Amersham Biosciences), fixed by ultraviolet cross-linking (2× auto cross-link on a Stratalink 2400 [Stratagene]), and subsequently baked for 1 h at 80°C. Membranes were probed with 10 pmol of 5′ 32P-labeled (T4 polynucleotide kinase [New England Biolabs]) DNA/LNA (locked nucleic acid) modified oligonucleotides (Proligo), complementary to the mature and precursor miRNAs. We used DNA/LNA probes, where every third position was substituted by a LNA nucleotide, in order to obtain an improved miRNA detection (Valoczi et al. 2004). LNA nucleotides are indicated by “*X.” The sequences for the probes were as follows: miR-138, 5′-C*GGC*CTG*ATT*CAC*AAC*ACC*AGC*T-3′. To differentiate between miRNA precursors and mature miRNAs, the following probes against the loop regions of the two different hairpins were designed and labeled: pre-miR-138-1, C*GTT*CTC*TGA*TTG*GCA*A-3′; pre-miR-138-2, 5′-G*GTA*AGA*GGA*TGC*GCT*GCT*CGT-3′. As a control for specificity of the probes, we used mismatch probes against pre-miR-138-2 and miR-138: mismatch-loop, 5′-TAAGAGGATGCGCTGCTAAAAAACCTGATTCACAACACCA-3′, and mismatch-mature, 5′-CGGCCTGATTAAAAAAACCAGCT-3′.

Prehybridization of membranes was carried out in a buffer containing 5× SSC, 20 mM Na2HPO4 (pH 7.2), 7% SDS, 1× Denhardt's solution, and 0.1 mg/mL sonicated salmon sperm DNA (Stratagene). Hybridizations were carried out in the same solution at 80°C. 5′-32P-labeled probes were heated for 1 min at 95°C before addition to the hybridization solution. After hybridization, the membranes were washed twice in 5× SSC, 5% SDS and once in 1× SSC, 1% SDS at 70°C for 1–2 min each. Northern blots were then analyzed by PhosphorImaging (Storm 860, Molecular Dynamics).

Cell culture

HeLa human cervix-carcinoma cells as well as N2A murine neuroblastoma cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) supplemented with 10% fetal calf serum (FCS) (Invitrogen), 100 u/mL penicillin (Sigma-Aldrich), 100 μg/mL penicillin/streptomycin (Sigma-Aldrich), and 20 mM HEPES (pH 7.3) at 37°C in an atmosphere containing 5% CO2 in 15-cm dishes up to 90%–95% confluency.

HeLa cells were transfected with the indicated amounts of pSUPER.neo+GFP plasmid (Oligoengine), where the sequences of pre-miR-124a or pre-miR-138-2 were previously inserted between the BglII and the HindIII restriction sites. For pre-miR-124a, we used 124a-fwd, 5′-GATCCCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATTAAGGCACGCGGTGAATGCCATTTTTA-3′, and 124a-rev, 5′-AGCTTAAAAATGGCATTCACCGCGTGCCTTAATTGTATGGACATTTAAATCAAGGTCCGCTGTGAACACGGG-3′. For pre-miR-138-2, we used 138-2-fwd, 5′-GATCCCCAGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCATCCTCTTACCCGGCTATTTCACGACACCAGGGTTTTTA-3′, and 138-2-rev, 5′-AGCTTAAAAACCCTGGTGTCGTGAAATAGCCGGGTAAGAGGATGCGCTGCTCGTCGGCCTGATTCACAACACCAGCTGGG-3′. Transfections were perfomed in 6-well plates (Nunc) using the Lipofectamine 2000 reagent (Invitrogen) with concentrations according to the product manual. Total RNA was isolated 6 h after the start of transfection as described above.

Preparation of cellular extracts

HeLa or N2A cells were briefly washed with 1× PBS and harvested in 1 mL of a buffer containing 100 mM KCl, 5 mM MgCl2, 10% glycerol, 30 mM HEPES (pH 7.4), 0.1 mM AEBSF, and 0.5 mM DTT by scraping with a rubber policeman. Cells were effectively lysed by sonication. The remaining cell debris was removed by centrifugation.

Nuclear and cytoplasmic extracts were prepared as previously described (Lehnertz et al. 2003). Briefly, to prepare cytoplasmic extracts, cells were harvested by trypsinization, washed, and pelleted by centrifugation. The pellet was resuspended in 1× PBS and pelleted again by spinning. PBS was removed, and the cell pellet was resuspended in cold buffer A (10 mM HEPES at pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF) by gentle pipetting. After swelling, a 10% solution of Nonidet NP–40 (Fluka) was added and the tube was vigorously vortexed. The homogenate was centrifuged, and the supernatant containing the cytoplasm and the cytoplasmic RNA was transferred to a fresh tube and subsequently used for RNA extraction and Northern blot analysis. Nuclei were prepared by centrifugation of the cells through a cushion of nuclear isolation buffer (20% [v/v] Ficoll-Paque Pharmacia, 80 mM Tris/HCl at pH 7.4, 8 mM MgCl2, 8 mM CaCl2, 1.6% [v/v] NP–40, 1.3% [v/v] Triton X-100, and 0.001% [v/v] DMSO). Nuclear pellets were washed once in ice-cold PBS, snap-frozen in liquid nitrogen, and subsequently used for the preparation of nuclear RNA. To obtain nuclear extracts, nuclei were resuspended in immunoprecipitation (IP) buffer (45 mM HEPES/NaOH at pH 7.5, 0.45 M NaCl, 0.9 mM EDTA, 0.9% [v/v] NP–40, 8.7% [v/v] glycerol, 1 mM NaF, 10 mM β-glycerophosphate, 1 tablet/50 mL protease inhibitor cocktail [Roche, no. 1836145]) and sonicated. After centrifugation, the supernatant was snap-frozen in liquid nitrogen and subsequently used for RNA extraction and Northern blot analysis.

In vitro processing assays

For in vitro processing assays, DNA templates encoding the sequences of various miRNAs were transcribed by T7 polymerase (MEGAshortscript T7, Ambion) in the presence of 32P-α-UTP (Amersham), thus generating radiolabeled, synthetic precursor miRNAs. The DNA templates were annealed to a T7 runoff DNA oligonucleotide (AATTTAATACGACTCACTATAGG) that spans the T7 promoter site. The sequences used were as follows: pre-miR-19a, 5′-TCAGTTTTGCATAGATTTGCACAACTACATTCTTCTTGTAGTGCAACTATGCAAAACCTATAGTGAGTCGTATTAA-3′; pre-miR-138-2, 5′-AACCCTGGTGTCGTGAAATAGCCGGGTAAGAGGATGCGCTGCTCGTCGGCCTGATTCACAACACCAGCCTATAGTGAGTCGTATTAA-3′. These synthetic precursors were folded into their hairpin-shaped structure by heating for 1 min at 95°C and cooling slowly to room temperature. Processing with recombinant Dicer was performed as previously described (Zhang et al. 2002). Precursors were used at a concentration of 10 nM and were pretreated for 10 min at 30°C with increasing amounts of HeLa cytoplasmic extract (2, 4, 6, 8, 16, 24, and 32 μg protein for pre-miR-138-2; 2, 6, 16, and 32 μg protein for pre-miR-19a). After 2 min incubation at 37°C, the reaction products were separated on a 15% denaturing PAGE and visualized by autoradiography.

In situ hybridizations

All mice were maintained at the animal facility at the IMP, under pathogen-free conditions. C57BL/6 mice were mated to generate embryos for analyses and the morning of the vaginal plug was considered as E0.5. Embryos, livers, and brains were post-fixed in 4% paraformaldehyde, cryoprotected (30% sucrose in PBS), embedded in Tissue-Tek OCT compound, and cryosectioned. Ten-micron cryosections were pretreated, hybridized with LNA digoxygenin-labeled probes (Exiqon), and washed according to Schaeren-Wiemers and Gerfin-Moser (1993), with some modifications. Probe sequences were as follows: miR-122a, 5′-ACAAACACCATTGTCACACTCCA-3′; miR-138, 5′-CGGCCTGATTCACAACACCAGCT-3′; and pre-miR-138-2, 5′-GGTAAGAGGATGCGCTGCTCGT-3′. Briefly, sections were fixed in 4% paraformaldehyde for 10 min, acetylated, and treated with 5 μg/mL proteinase K (Roche) in PBS for 5 min, washed, and prehybridized for 4 h at room temperature. Hybridization with 22-nt LNA probes (Tm ∼ 80°C) was performed at 55°C overnight. Slides were then washed at 60°C and incubated with alkaline phophatase-conjugated goat anti-DIG Fab fragments (1:2000 [Roche]) at 4°C overnight. Fluorescent detection was performed using a Fast Red reaction (Dako Cytomation) for 1 h at room temperature. Sections were analyzed with a with a Zeiss Axioplan-2 microscope and photographed with a digital camera (Coolsnap HQ, Photometrics). A subset of images was adjusted for levels, brightness, contrast, hue, and saturation with Adobe Acrobat 7.0 imaging software to optimally visualize the expression patterns.

SUPPLEMENTAL MATERIAL

Supplemental Material can be found at http://www.imba.oeaw.ac.at/index.php?id=142.

ACKNOWLEDGMENTS

We thank Stefan Ameres, Stefan Weitzer, and the members of the laboratory for encouragement and suggestions during the completion of this work, and Prof. Renée Schroeder for critically reading the manuscript. J.M. is a Junior Group Leader at IMBA. P.J.F.L. is funded by the Boehringer Ingelheim Fonds Ph.D. Scholarship. M.A. was supported by an EMBO long-term fellowship and a Marie Curie fellowship.

Footnotes

Article published online ahead of print. Article and publication date are at http://www.rnajournal.org/cgi/doi/10.1261/rna.2322506.

REFERENCES

  1. Ambros V., Lee R.C., Lavanway A., Williams P.T., Jewell D. MicroRNAs and other tiny endogenous RNAs in C. elegans . Curr. Biol. 2003;13:807–818. doi: 10.1016/s0960-9822(03)00287-2. [DOI] [PubMed] [Google Scholar]
  2. Babak T., Zhang W., Morris Q., Blencowe B.J., Hughes T.R. Probing microRNAs with microarrays: Tissue specificity and functional inference. RNA. 2004;10:1813–1819. doi: 10.1261/rna.7119904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barad O., Meiri E., Avniel A., Aharonov R., Barzilai A., Bentwich I., Einav U., Gilad S., Hurban P., Karov Y., et al. MicroRNA expression detected by oligonucleotide microarrays: System establishment and expression profiling in human tissues. Genome Res. 2004;14:2486–2494. doi: 10.1101/gr.2845604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bartel D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–297. doi: 10.1016/s0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
  5. Bentwich I., Avniel A., Karov Y., Aharonov R., Gilad S., Barad O., Barzilai A., Einat P., Einav U., Meiri E., et al. Identification of hundreds of conserved and nonconserved human microRNAs. Nat. Genet. 2005;37:766–770. doi: 10.1038/ng1590. [DOI] [PubMed] [Google Scholar]
  6. Berezikov E., Guryev V., van de Belt J., Wienholds E., Plasterk R.H., Cuppen E. Phylogenetic shadowing and computational identification of human microRNA genes. Cell. 2005;120:21–24. doi: 10.1016/j.cell.2004.12.031. [DOI] [PubMed] [Google Scholar]
  7. Bernstein E., Caudy A.A., Hammond S.M., Hannon G.J. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 2001;409:363–366. doi: 10.1038/35053110. [DOI] [PubMed] [Google Scholar]
  8. Bohnsack M.T., Czaplinski K., Gorlich D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA. 2004;10:185–191. doi: 10.1261/rna.5167604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Calin G.A., Liu C.G., Sevignani C., Ferracin M., Felli N., Dumitru C.D., Shimizu M., Cimmino A., Zupo S., Dono M., et al. MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc. Natl. Acad. Sci. 2004;101:11755–11760. doi: 10.1073/pnas.0404432101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Griffiths-Jones S. The microRNA registry. Nucleic Acids Res. 2004;32:D109–D111. doi: 10.1093/nar/gkh023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hutvágner G., McLachlan J., Bálint, É., Tuschl T., Zamore P.D. A cellular function for the RNA interference enzyme Dicer in small temporal RNA maturation. Science. 2001;93:834–838. doi: 10.1126/science.1062961. [DOI] [PubMed] [Google Scholar]
  12. Ketting R.F., Fischer S.E., Bernstein E., Sijen T., Hannon G.J., Plasterk R.H. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans . Genes & Dev. 2001;15:2654–2659. doi: 10.1101/gad.927801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Khvorova A., Reynolds A., Jayasena S.D. Functional siRNAs and miRNAs exhibit strand bias. Cell. 2003;115:209–216. doi: 10.1016/s0092-8674(03)00801-8. [DOI] [PubMed] [Google Scholar]
  14. Knight S.W., Bass B.L. A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in C. elegans . Science. 2001;2:2. doi: 10.1126/science.1062039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lagos-Quintana M., Rauhut R., Lendeckel W., Tuschl T. Identification of novel genes coding for small expressed RNAs. Science. 2001;294:853–858. doi: 10.1126/science.1064921. [DOI] [PubMed] [Google Scholar]
  16. Lagos-Quintana M., Rauhut R., Yalcin A., Meyer J., Lendeckel W., Tuschl T. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 2002;12:735–739. doi: 10.1016/s0960-9822(02)00809-6. [DOI] [PubMed] [Google Scholar]
  17. Lee Y., Ahn C., Han J., Choi H., Kim J., Yim J., Lee J., Provost P., Radmark O., Kim S., et al. The nuclear RNase III Drosha initiates microRNA processing. Nature. 2003;425:415–419. doi: 10.1038/nature01957. [DOI] [PubMed] [Google Scholar]
  18. Lehnertz B., Ueda Y., Derijck A.A., Braunschweig U., Perez-Burgos L., Kubicek S., Chen T., Li E., Jenuwein T., Peters A.H. Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr. Biol. 2003;13:1192–1200. doi: 10.1016/s0960-9822(03)00432-9. [DOI] [PubMed] [Google Scholar]
  19. Lim L.P., Glasner M.E., Yekta S., Burge C.B., Bartel D.P. Vertebrate microRNA genes. Science. 2003;299:1540. doi: 10.1126/science.1080372. [DOI] [PubMed] [Google Scholar]
  20. Liu C.G., Calin G.A., Meloon B., Gamliel N., Sevignani C., Ferracin M., Dumitru C.D., Shimizu M., Zupo S., Dono M., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. 2004;101:9740–9744. doi: 10.1073/pnas.0403293101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lund E., Guttinger S., Calado A., Dahlberg J.E., Kutay U. Nuclear export of microRNA precursors. Science. 2004;303:95–98. doi: 10.1126/science.1090599. [DOI] [PubMed] [Google Scholar]
  22. Miska E.A., Alvarez-Saavedra E., Townsend M., Yoshii A., Sestan N., Rakic P., Constantine-Paton M., Horvitz H.R. Microarray analysis of microRNA expression in the developing mammalian brain. Genome Biol. 2004;5:R68. doi: 10.1186/gb-2004-5-9-r68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. O'Donnell K.A., Wentzel E.A., Zeller K.I., Dang C.V., Mendell J.T. c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005;435:839–843. doi: 10.1038/nature03677. [DOI] [PubMed] [Google Scholar]
  24. Pillai R.S. MicroRNA function: Multiple mechanisms for a tiny RNA? RNA. 2005;11:1753–1761. doi: 10.1261/rna.2248605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Rodriguez A., Griffiths-Jones S., Ashurst J.L., Bradley A. Identification of mammalian microRNA host genes and transcription units. Genome Res. 2004;14:1902–1910. doi: 10.1101/gr.2722704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Schaeren-Wiemers N., Gerfin-Moser A. A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: In situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry. 1993;100:431–440. doi: 10.1007/BF00267823. [DOI] [PubMed] [Google Scholar]
  27. Schwartz S., Zhang Z., Frazer K.A., Smit A., Riemer C., Bouck J., Gibbs R., Hardison R., Miller W. PipMaker–A web server for aligning two genomic DNA sequences. Genome Res. 2000;10:577–586. doi: 10.1101/gr.10.4.577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Schwarz D.S., Hutvagner G., Du T., Xu Z., Aronin N., Zamore P.D. Asymmetry in the assembly of the RNAi enzyme complex. Cell. 2003;115:199–208. doi: 10.1016/s0092-8674(03)00759-1. [DOI] [PubMed] [Google Scholar]
  29. Sempere L.F., Freemantle S., Pitha-Rowe I., Moss E., Dmitrovsky E., Ambros V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 2004;5:R13. doi: 10.1186/gb-2004-5-3-r13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Valoczi A., Hornyik C., Varga N., Burgyan J., Kauppinen S., Havelda Z. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 2004;32:e175. doi: 10.1093/nar/gnh171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Weber M.J. New human and mouse microRNA genes found by homology search. FEBS J. 2005;272:59–73. doi: 10.1111/j.1432-1033.2004.04389.x. [DOI] [PubMed] [Google Scholar]
  32. Yi R., Qin Y., Macara I.G., Cullen B.R. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes & Dev. 2003;17:3011–3016. doi: 10.1101/gad.1158803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Zhang H., Kolb F.A., Brondani V., Billy E., Filipowicz W. Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP. EMBO J. 2002;21:5875–5885. doi: 10.1093/emboj/cdf582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zhao Y., Samal E., Srivastava D. Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature. 2005;436:214–220. doi: 10.1038/nature03817. [DOI] [PubMed] [Google Scholar]

Articles from RNA are provided here courtesy of The RNA Society

RESOURCES