Skip to main content
. 2006 Jul;80(14):6952–6963. doi: 10.1128/JVI.00187-06

FIG. 2.

FIG. 2.

Loci of the NeabNPV genome with repeating elements. The triangles represent the repeated core element in the direction indicated by the point. The name and genome location of the repeat region are indicated on the right, and the repeat element consensus sequences are as follows: A, ATAAAAAACAGTAAATATT(C/T)CAATACGATGC AAACGCACGTGATTAATGT; B, TCAG(A/C)ATTGTCGTTGTTGTTTT(G/C)AG TGTTTTCTGT(G/A)TTATTTC; C, AGATGTCGCGTTTGTTGGGCTCGAGGT CCAACACATTTGACAAGTTG. White arrows indicate the orientation and location of NeabNPV ORFs depicted in Fig. 4.