FIG. 2.

EBV latent gene LMP-1 increases STAT1 protein expression, STAT transcriptional activity, and STAT1 nuclear DNA binding. (A) DG75 cells were transfected with 3 μg of LMP-1 expression vector by electroporation using a Bio-Rad Genepulser II electroporator set to 270 V and 950 μF. Typically, 10 million DG75 cells were used per transfection. The total amount of DNA used in each transfection was kept constant by the addition of an appropriate amount of pSG5 empty vector. At 48 h posttransfection, total lysates were prepared and analyzed by SDS-PAGE and Western blotting using antibodies specific to STAT1 and LMP-1 proteins. The results shown are representative of four separate experiments. (B) DG75 cells were transfected with various amounts of an LMP-1 expression vector and a STAT reporter containing five copies of the FcγR1-GAS (GRR) GTATTTCCCAGAAAAGGAAC consensus sequence upstream of a luciferase gene. After 18 h, cells were harvested, lysed, and assayed for levels of luciferase. (C) Using the agarose-coupled GRR oligonucleotide, DNA binding complexes were affinity precipitated from nuclear extracts of the two BJAB cell lines stably expressing LMP-1 and two control cell lines. DNA binding proteins were separated by SDS-PAGE and analyzed by Western blotting using an antibody specific to STAT1 protein. The results shown are representative of two separate experiments.