TABLE 1.
Genes whose expression was identified as being QS regulated by using microarraysa
| ORF or intergenic region (ig) | Gene name | Change in PAO-JP2 (induced to uninduced) (fold)b | Growth stagec | Protein descriptiond | las boxe |
|---|---|---|---|---|---|
| QS-promoted genes | |||||
| PA0052 | 6.7 | ES | Hypothetical protein | ||
| PA0105 | coxB | 5.7 | ES | Cytochrome c oxidase subunit II | ACCTGGCTGATCTGATAGCC (R) (−456 to −437) |
| PA0107 | 6.1 | ES | Conserved hypothetical protein | ||
| PA0122 | 29 | ES | Conserved hypothetical protein | GCCTACCAGATCTGGCAGGC (D), GCCTGCCAGATCTGGTAGGC (R) (−166 to −147) | |
| PA0144 | 17 | ES | Hypothetical protein | ||
| PA0399 | 5.2 | ML | Cystathionine beta-synthase | ||
| PA0447 | gcdH | 7.8 | ML | Glutaryl-coenzyme A dehydrogenase | |
| PA0572 | 7.8 | B | Hypothetical protein | ||
| PA0588 | 7.4 | ML | Conserved hypothetical protein | ||
| PA0744 | 7.0 | ML | Probable enoyl-coenzyme A hydratase/isomerase | ||
| PA0745 | 8.2 | ML | Probable enoyl-coenzyme A hydratase/isomerase | ||
| PA0852f | cpbD | 18 | ES | Chitin-binding protein CbpD precursor | |
| PA0997 | 5.9 | B | Hypothetical protein | ||
| PA0998 | 7.2 | B | Hypothetical protein | ||
| PA0999 | fabH1 | 5.1 | B | 3-Oxoacyl-(acyl carrier protein) synthase III | |
| PA1130f | 7.4 | B | Hypothetical protein | ||
| PA1131f | 5.4 | B | Probable MFS transporter | ||
| PA1212 | 6.9 | ES | Probable MFS transporter | ||
| PA1214 | 5.0 | ES | Hypothetical protein | TCCTGGGTGTTCAGCCAGCC (D) (−381 to −362) | |
| PA1217 | 30 | ES | Probable 2-isopropylmalate synthase | GCCTACCCGATGTTCAAGTG (D) (−438 to −419) | |
| PA1219 | 5.3 | ES | Hypothetical protein | ||
| PA1246 | aprD | 6.3 | ML | Alkaline protease secretion protein AprD | |
| PA1249f | aprA | 6.9 | B | Alkaline metalloproteinase precursor | |
| PA1250 | aprI | 12 | B | Alkaline proteinase inhibitor AprI | |
| PA1318 | cyoB | 5.7 | ES | Cytochrome o ubiquinol oxidase subunit I | |
| PA1431f,g | rsaL | 7.7 | B | Regulatory protein RsaL | AACTAGCAAATGAGATAGAT (D) (−77 to −58)h |
| PA1657 | 6.6 | ML | Conserved hypothetical protein | ||
| PA1784 | 7.3 | ES | Hypothetical protein | CCCTATCCGTTCTGGGAGCT (R) (−140 to −121) | |
| PA1869f | 79 | B | Probable acyl carrier protein | CACTGCCAGATCTGGCAGTT (D), AACTGCCAGATCTGGCAGTG (R) (−90 to −71) | |
| PA1871f | lasA | 29 | ES | LasA protease precursor | |
| PA1874 | 9.9 | ES | Hypothetical protein | ||
| PA1875 | 9.1 | ES | Hypothetical protein | ||
| PA1894f | 25 | ES | Hypothetical protein | ||
| PA1895 | 11 | ES | Hypothetical protein | ||
| PA1896f | 11 | ES | Hypothetical protein | ||
| PA1897g | 33 | B | Hypothetical protein | ACCTGCCCGGAAGGGCAGGT (D), ACCTGCCCGGAAGGGCAGGT (R) (−288 to −269) | |
| PA1901f | 16 | ES | Phenazine biosynthesis protein PhzC | ||
| PA1902 | 42 | ES | Phenazine biosynthesis protein PhzD | ||
| PA1903 | 26 | B | Phenazine biosynthesis protein PhzE | ||
| PA1904 | 51 | B | Probable phenazine biosynthesis protein | ||
| PA1905 | 22 | B | Probable pyridoxamine 5-phosphate oxidase | ||
| PA1927 | metE | 20 | ES | Methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase | |
| PA1999 | 32 | ML | Probable coenzyme A transferase subunit A | ||
| PA2000 | 46 | ML | Probable coenzyme A transferase subunit B | ||
| PA2001 | atoB | 23 | ML | Acetyl-coenzyme A acetyltransferase | |
| PA2014 | 7.5 | ML | Probable acyl-coenzyme A carboxyltransferase beta chain | ||
| PA2030 | 7.3 | B | Hypothetical protein | ||
| PA2068 | 8.6 | ES | Probable MFS transporter | ||
| PA2069 | 8.8 | ES | Probable carbamoyl transferase | GCCTGCGAAATCTGGCAGGG (D) (−109 to −90) | |
| PA2193f | hcnA | 210 | B | Hydrogen cyanide synthase HcnA | ACCTACCAGAATTGGCAGGG (D), CCCTGCCAATTCTGGTAGGT (R) (−112 to −93)h |
| PA2194f | hcnB | 52 | B | Hydrogen cyanide synthase HcnB | |
| PA2195 | hcnC | 30 | B | Hydrogen cyanide synthase HcnC | |
| PA2196 | 5.3 | ML | Probable transcriptional regulator | ||
| PA2250 | lpdV | 7.8 | ML | Lipoamide dehydroger ase-Val | |
| PA2300 | chiC | 5.1 | ES | Chitinase | ACCTACCACAATTGGCAGAG (D) (−193 to −174) |
| PA2302f | 27 | ES | Probable nonribosomal peptide synthetase | ||
| PA2303 | 10 | B | Hypothetical protein | ||
| PA2304 | 14 | ES | Hypothetical protein | ||
| PA2305 | 28 | B | Probable nonribosomal peptide synthetase | ||
| PA2306 | 13 | ES | Conserved hypothetica protein | ||
| PA2331 | 9.4 | ES | Hypothetical protein | ||
| PA2366 | 7.5 | ES | Conserved hypothetical protein | /PICK> | |
| PA2367 | 6.3 | ES | Hypothetical protein | ||
| PA2423 | 12 | B | Hypothetical protein | ||
| PA2552 | 10 | ML | Probable acyl-coenzyme A dehydrogenase | ||
| PA2553 | 14 | ML | Probable acyl-coenzyme A thiolase | ||
| PA2554 | 11 | ML | Probable short-chain dehydrogenase | ||
| PA2555 | 6.2 | ML | Probable AMP-binding enzyme | ||
| PA2564 | 11 | ES | Hypothetical protein | ||
| PA2565 | 5.5 | ES | Hypothetical protein | ||
| PA2566 | 10 | ES | Conserved hypothetical protein | CCCTGCCAGTTCTGGTAGGC (D), GCCTACCAGAACTGGCAGGG (R) (−157 to −138) | |
| PA2570f | palL | 60 | ES | PA-I galactophilic lectin | |
| PA2587f | 16 | B | Probable FAD-dependent monooxygenase | CCCTATCAGAAGATCGAGTT (D) (−126 to −107) | |
| PA2588 | 6.9 | B | Probable transcriptional regulator | ||
| PA2591f | 5.7 | B | Probable transcriptional regulator | AACTACCAGTTCTGGTAGGT (D) (−115 to −96) | |
| PA2592f,g | 5.6 | B | Probable periplasmic spermidine-putrescine- binding protein | AACTACCAGTTCTGGTAGGT (D) (−59 to −40) | |
| PA2939 | 16 | ES | Probable aminopeptidase | ||
| PA3032f | snr-1 | 10 | B | Cytochrome c | |
| PA3326f | 8.7 | B | Probable Clp family ATP-dependent protease | ACCTAACAGATTTGTAAGTT (D) (−241 to −222) | |
| PA3328f | 15 | ES | Probable FAD-dependent monooxygenase | ||
| PA3329f | 55 | ES | Hypothetical protein | ||
| PA3330f | 38 | ML | Probable short-chain dehydrogenase | ||
| PA3331f | 16 | B | Cytochrome P450 | ||
| PA3332 | 15 | B | Conserved hypothetical protein | ||
| PA3333f | fabH2 | 32 | B | 3-Oxoacyl-(acyl carrier protein) synthase III | |
| PA3334 | 23 | B | Probable acyl carrier protein | ||
| PA3335 | 5.1 | B | Hypothetical protein | ||
| PA3361 | 51 | ES | Hypothetical protein | ||
| PA3477f | rhlR | 5.9 | ES | Transcriptional regulator RhlR | |
| PA3478f | rhlB | 37 | ES | Rhamnosyltransferase chain B | |
| PA3479f | rhlA | 100 | ES | Rhamnosyltransferase chain A | TCCTGTGAAATCTGGCAGTT (D) (−288 to −269)h |
| PA3519 | 16 | ES | Hypothetical protein | ||
| PA3520 | 70 | ES | Hypothetical protein | ||
| PA3709 | 5.2 | ML | Probable MFS transporter | ||
| PA3721 | 5.8 | ES | Probable transcriptional regulator | ||
| PA3724f | lasB | 39 | B | Elastase LasB | ACCTGCCAGTTCTGGCAGGT (D), ACCTGCCAGTTCTGGCAGGT (R) (−194 to −175)h |
| PA3904 | 18 | ML | Hypothetical protein | ||
| PA3906 | 5.8 | B | Hypothetical protein | ||
| PA3908 | 5.9 | B | Hypothetical protein | ||
| PA3923 | 12 | ML | Hypothetical protein | ||
| PA4078f | 7.6 | ES | Probable nonribosomal peptide synthetase | ||
| PA4129 | 14 | B | Hypothetical protein | ||
| PA4130 | 12 | B | Probable sulfite or nitrite reductase | ||
| PA4131 | 6.8 | ES | Probable iron-sulfur protein | ||
| PA4132 | 8.1 | ES | Conserved hypothetical protein | ||
| PA4133 | 46 | ES | Cytochrome c oxidase subunit (cbb3 type) | ||
| PA4134 | 22 | ES | Hypothetical protein | ||
| PA4141 | 25 | B | Hypothetical protein | ||
| PA4142 | 9.6 | B | Probable secretion protein | ||
| PA4175 | 5.5 | ES | Probable endoproteinase Arg-C precursor | ||
| PA4205 | mexG | 8.0 | ES | Hypothetical protein | |
| PA4206 | mexH | 5.5 | ES | Probable RND efflux membrane fusion protein precursor | |
| PA4207f | mexI | 6.2 | ES | Probable RND efflux transporter | |
| PA4208 | opmD | 6.2 | ES | Probable outer membrane efflux protein precursor | |
| PA4209 | 14 | B | Probable O-methyltransferase | ACCTACCAGATCTTGTAGTT (D) (−327 to −308) | |
| PA4211 | 74 | B | Probable phenazine biosynthesis protein | ||
| PA4217f | 19 | ES | Probable FAD-dependent monooxygenase | ||
| PA4293 | 6.6 | ES | Probable two-component sensor | ||
| PA4294 | 8.6 | ES | Hypothetical protein | ||
| PA4297 | 7.5 | ES | Hypothetical protein | GCCTGGCTGGCCATCCAGGC (R) (−190 to −171) | |
| PA4298 | 6.8 | ES | Hypothetical protein | ||
| PA4299 | 8.9 | ES | Hypothetical protein | ||
| PA4300 | 7.7 | ES | Hypothetical protein | ||
| PA4302 | 9.6 | ES | Probable type II secretion system protein | ||
| PA4303 | 5.2 | ES | Hypothetical protein | ||
| PA4304 | 6.7 | ES | Probable type II secretion system protein | ||
| PA4305 | 7.3 | ES | Hypothetical protein | ||
| PA4306 | 28 | ES | Hypothetical protein | ||
| PA4496 | 10 | ML | Probable binding protein component of ABC transporter | ||
| PA4648 | 14 | ES | Hypothetical protein | ||
| PA4651 | 8.8 | ES | Probable pilus assembly chaperone | ||
| PA4677 | 15 | B | Hypothetical protein | ||
| PA4878 | 8.8 | B | Probable transcriptional regulator | ||
| PA5059 | 11 | ES | Probable transcriptional regulator | ||
| PA5220 | 19 | ML | Hypothetical protein | ||
| ig 4713795-4713098 | 47 | ES | Intergenic region between PA4280 and PA4281, 4713098-4713795, (−) strand | ||
| QS-repressed genes | |||||
| PA0040 | 5.6 | ES | Conserved hypothetical protein | ||
| PA0509 | nirN | 4.7 | ES | Probable c-type cytochrome | |
| PA0510 | 4.1 | ES | Probable uroporphyrin-III c-methyltransferase | ||
| PA0512 | 3.2 | ES | Conserved hypothetical protein | ||
| PA0714 | 3.2 | ES | Hypothetical protein | ||
| PA1978 | 6.1 | ES | Probable transcriptional regulator | ||
| PA1983 | exaB | 12 | ES | Cytochrome c550 | |
| PA1984 | 5.5 | ES | Probable aldehyde dehydrogenase | ||
| PA2259 | ptxS | 3.6 | ML | Transcriptional regulator PtxS | |
| PA2260 | 13 | ML | Hypothetical protein | ||
| PA2261 | 18 | ML | Probable 2-ketogluconate kinase | ||
| PA2321 | 3.2 | ML | Gluconokinase | ||
| PA2539 | 4.5 | ML | Conserved hypothetical protein | ||
| PA2540 | 3.0 | ML | Conserved hypothetical protein | ||
| PA2711 | 3.0 | ES | Probable periplasmic spermidine-putrescine- binding protein | ||
| PA2903 | cobJ | 3.3 | ML | Precorrin-3 methylase CobJ | |
| PA3391 | nosR | 3.0 | ES | Regulatory protein NosR | |
| PA3392 | nosZ | 3.8 | ES | Nitrous oxide reductase precursor | TACTGCCTCGACTGCCAGAT (D) (−168 to −149) |
| PA3393 | nosD | 3.5 | ES | NosD protein | |
| PA3394 | nosF | 4.4 | ES | NosF protein | |
| PA3395 | nosY | 4.8 | ES | NosY protein | |
| PA3396 | nosL | 4.3 | ES | NosL protein | |
| PA3662 | 4.6 | ES | Hypothetical protein | ||
| PA3870 | moaA1 | 5.1 | ES | Molybdopterin biosynthetic protein A1 | |
| PA3871 | 6.4 | B | Probable peptidyl-prolyl cis-trans isomerase, PpiC type | ||
| PA3872 | narI | 6.1 | ES | Respiratory nitrate reductase gamma chain | |
| PA3873 | narJ | 6.1 | B | Respiratory nitrate reductase delta chain | |
| PA3874 | narH | 8.5 | ES | Respiratory nitrate reductase beta chain | |
| PA3875 | narG | 8.3 | ES | Respiratory nitrate reductase alpha chain | |
| PA3876 | narK2 | 11 | ES | Nitrite extrusion protein 2 | |
| PA3877 | narK1 | 13 | ES | Nitrite extrusion protein 1 | ATCTGTCCCGCTGGTCAGCG (R) (−217 to −198 in ORF of narX) |
| PA3911 | 3.7 | ES | Conserved hypothetical protein | ||
| PA3912 | 5.1 | ES | Conserved hypothetical protein | ||
| PA3913 | 6.5 | ES | Probable protease | ||
| PA3914 | moeAI | 6.9 | ES | Molybdenum cofactor biosynthetic protein A1 | |
| PA3916 | moaE | 7.5 | ES | Molybdopterin converting factor large subunit | |
| PA3917 | moaD | 8.0 | ES | Molybdopterin converting factor small subunit | |
| PA3918 | moaC | 6.1 | ES | Molybdopterin biosynthetic protein C | |
| PA4587 | ccpR | 3.9 | ES | Cytochrome c551 peroxidase precursor | |
| PA4628 | lysP | 3.4 | ML | Lysine-specific permease | |
| PA4918 | 3.0 | ML | Hypothetical protein | ||
| ig 2923366-2922568 | 6.4 | ML | Intergenic region between PA2587 and PA2588, 2922568-2923366, (−) strand |
a
Only genes identified as being QS regulated that were differentially expressed with a magnitude of change of ≥5-fold (QS promoted) or of ≥3-fold (QS repressed) are included. A list of all genes identified as being QS regulated exhibiting a statistically significant change (P ≤ 0.05) is available online (http://www.urmc.rochester.edu/smd/mbi/bhi/). Genes are identified by ORF designation, gene name, and protein description (http://www.pseudomonas.com).
b
The magnitude of transcript induction was calculated for PAO-JP2 grown with exogenous autoinducers (1 μM 3O-C12-HSL and 2 μM C4-HSL) compared to PAO-JP2 cultures grown aerobically in modified FAB. The values are reported for the early stationary phase when differential expression was observed in both gr
c
Growth stage(s) during which statistically significant differential transcript expression (P ≤ 0.05) was exhibited. ML, mid-logarithmic phase; ES, early stationary phase; B, both mid-logarithmic and early stationary phases.
d
FAD, flavin adenine dinucleotide; RND, resistance-nodulation-cell division; MFS, major facilitator superfamily; ABC, ATP-binding cassette.
e
The orientation of the consensus sequence is indicated in parentheses (D, directly upstream of the ORF; R, opposite strand). The numbers in parentheses are sequence positions.
g
Gene possessing overlapping las boxes upstream of adjacent ORFs of currently identified QS-regulated genes.