Table III.

Transient expression assay of endosperm-box motif/−46 CaMV/GUS reporter genes in rice callus protoplasts

The endosperm box (WT: ACATAAAGTGAGTGATGAGTCATAATA) of NRP33 was fused to a −46 CaMV/GUS reporter gene. An endosperm box containing a mutation either in the P-box (M1: ACATAcccTGAGTGATGAGTCATAATA) or GCN4 motif (M2: ACATAAAGTGAGTcccccccccTAATA) was used as a negative control. Each of the reporter genes was electroporated into protoplasts in the presence of RISBZ1, RPBF, or RISBZ1 + RPBF. The results shown are the mean ± sd.

Reporter	Effector (Fold Induction)
		RISBZ1	RPBF	RISBZ1 + RPBF
WT endosperm box/−46 CaMV	15.18 ± 3.32	1.26 ± 0.23	62.63 ± 9.32
M1 endosperm box/−46 CaMV	16.33 ± 4.03	1.11 ± 0.07	28.91 ± 11.52
M2 endosperm box/−46 CaMV	2.35 ± 0.65	0.92 ± 0.14	6.77 ± 0.71