Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2003 Apr 2;100(8):4813–4818. doi: 10.1073/pnas.0730710100

T cell leukemia I oncogene expression depends on the presence of Epstein–Barr virus in the virus- carrying Burkitt lymphoma lines

Csaba Kiss *,, Jun Nishikawa *, Kenzo Takada , Pankaj Trivedi §, George Klein *, Laszlo Szekely *
PMCID: PMC153638  PMID: 12672960

Abstract

We used a modified subtractive suppression hybridization to identify cellular genes that show altered expression in Burkitt lymphomas (BLs) in the presence of Epstein–Barr virus (EBV). Comparison of the gene expression patterns of an EBV-negative clone of the originally EBV-positive BL line Akata, with its NeoR-EBV derivative, revealed a significant difference in the expression of the T cell leukemia 1 oncogene (TCL-1). Subsequent expression studies showed that the original EBV-positive Akata line and the EBV-reconstituted derivative expressed high levels of TCL-1, whereas the EBV-negative variant showed only a low level of expression. Two other independently established EBV-positive BLs (Mutu and OMA) that have also thrown off EBV showed a similar decrease in TCL-1 expression after virus loss. Reinfection with NeoR-EBV restored the TCL-1 expression levels in the EBV loss variants to as high a level as the originally EBV-positive lines. High-resolution immunostaining showed that TCL-1 was localized in both the cytoplasm and the nucleus. Our findings suggest that high expression of TCL-1 is necessary for the development of the BL phenotype. In view of the fact that germinal center B cells, regarded as the progenitors of BL, do not express TCL-1, we suggest that constitutive expression of this oncogene occurs by genetic or epigenetic changes in the EBV-negative BLs. In the originally EBV-positive BLs, the ability of the virus to switch on TCL-1 expression would obviate this need.


Epstein–Barr virus (EBV) is associated with >90% of African endemic Burkitt lymphomas (BLs). It is present less frequently (15–20%) in sporadic cases worldwide (1). The hallmark of BL is the juxtaposition of the c-myc gene to the Ig heavy- or light-chain gene by chromosomal translocation, which results in the constitutive expression of c-myc (2). The contribution of EBV to BL genesis is still controversial. That EBV-negative BLs carry the same Ig/myc translocation as EBV-positives BLs raises the question whether EBV contributes to the pathogenesis of BL at all or is merely a passenger. Although a passenger role cannot be entirely excluded, it is made unlikely by the fact that only a very small fraction of normal B cells (<0.1%) carry the virus, even in highly infected African populations. Because 98% of the high endemic BLs are EBV positive, the probability that a B cell turns into a BL cell is higher if it carries the virus. Prospective epidemiological studies are also consistent with a contribution of a heavy EBV load to the genesis of the lymphoma (3). BLs usually carry multiple viral episomes.

The virus expresses only a limited number of genes in BL cells, including the nuclear antigen EBNA1, required for episomal maintenance, the small RNAs EBER-1 and -2, and the mRNA encoded by the ORF BARF0. This expression program is termed latency I. The cellular phenotype of EBV-positive BL lines with type I latency is similar to the EBV-negative BLs. They do not show any significant difference in surface marker expression, growth rate, serum requirement, agarose clonability and tumorigenicity in immunosuppressed mice. They both differ from EBV-positive BL lines that have undergone a phenotypic switch during in vitro culturing and express the full set of transforming genes (EBNA1–6 and LMP1 and -2). The latter expression program, referred to as type III latency, corresponds to in vitro EBV immortalized normal B cells and to immunoblastic lymphomas that arise in immunocompromised individuals.

The contribution of EBV to the growth and/or tumorigenicity of the EBV-positive BLs is an unsolved question. It has been suggested that the virus may act by enhancing the apoptosis resistance of the Ig/myc translocation carrying BL progenitor cells (4).

A novel possibility in the genesis of BL has been provided by the discovery that some of the type I BL lines may lose the virus during in vitro propagation (57). The loss of the virus from an originally EBV-positive BL leads to decreased tumorigenicity, agar clonability, and increased serum sensitivity (5, 8). A comparison of gene expression in the original EBV-positive lines with their EBV-negative and, subsequently, EBV-reconstituted daughter lines may permit the identification of cellular genes that are influenced by the presence of EBV in type I BL cells.

We have chosen the Akata cell line, an EBV-positive BL line derived from a Japanese patient (9), to analyze EBV-dependent changes in gene expression. This cell line retains its latency I program during long-term in vitro culture. However, it tends to lose its EBV genomes spontaneously, giving rise to virus-negative sublines. As long as they carry the virus, Akata cells can be readily induced to enter the lytic cycle by exposure to anti-Ig antibodies (10). The EBV-negative Akata subline can be reinfected with EBV. A recombinant Akata virus that carries a Neomycin resistance gene, stably integrated at the BXLF1 site, termed the EBV-NeoR, is particularly useful for reinfection and the establishment of new EBV carrying lines (11).

To identify target genes switched on by the virus that may contribute to the malignant phenotype, we have compared the gene expression profiles of EBV carrying and EBV-negative Akata lines by using suppressive subtraction hybridization (SSH) protocol, recently modified by us (12). By using SSH, we identified TCL-1, a cellular protooncogene, as a gene that showed low expression in the EBV-negative Akata and that was up-regulated on reintroduction of the virus.

TCL-1 was first identified by its involvement in chromosomal translocations or inversions affecting its site on chromosome 14q32.1 and its concurrent constitutive activation in prolymphocytic T cell leukemias (13). It is also involved in acute and chronic T cell leukemias that arise in ataxia–telangiectasia patients. The translocation leads to the juxtaposition of the TCL-1 locus to the α/δ or the β T cell receptor locus at 14q11 and 7q35, respectively (1416). Introduction of a human TCL-1 gene juxtaposed to the Ick promoter into transgenic mice resulted in the development of mature T cell leukemias (17). TCL-1 is highly expressed in both EBV-positive and -negative BLs as well as in lymphoblastoid cell lines (LCLs) (18). Transgenic mice that overexpressed TCL-1 in both B and T cells developed Burkitt-like lymphoma with very high penetrance (19). TCL-1 is also overexpressed in many human mature B cell lymphomas. The data presented below suggest that EBV might be responsible for the induction of TCL-1 in EBV-positive BLs.

Materials and Methods

Cell Lines.

Altogether, 42 cell lines were used, including 35 BL lines (16 EBV positives and 19 EBV negatives), four LCLs, two human herpes virus 8 (HHV-8)-carrying body-cavity lymphoma lines, and one B cell lymphoma line (see Tables 2 and 3 and Fig. 2). All lines were grown in Iscove's medium supplied with 10% FCS and antibiotics. G418 was added at a 500-μg/ml concentration to the EBV-NEOR infected cell lines.

Table 2.

Northern hybridizations on EBV-negative and -positive BL line pairs

graphic file with name pq07307100t2.jpg

Table 3.

Additional Northern hybridizations for TCL1 expression

graphic file with name pq07307100t3.jpg
*

EBV convertant of the BL41 line with B95-8 virus. 

B cells purified from tonsil by rosetting with sheep red blood cells. 

This cell line contains the P3H3 virus, which is deficient in EBNA-2. 

§

HHV-8 containing body-cavity lymphoma (BCL) lines. 

Figure 2.

Figure 2

Western blot analysis of TCL-1 expression in the EBV-positive and -negative sublines of Akata, Mutu, and OMA BLs. Akata 26–43, Mutu 9, OMA 2 and 5 are independently established EBV-negative BLs. Mutu III is a subline of the original Mutu line that drifted to the latency 3 expression program.

SSH.

A modified SSH was performed between the EBV loss subline of Akata designated Akata 17 (used as driver) and the Akata 17 EBV-NEOR line infected with the EBV-NeoR virus (used as tester) cell lines. For a detailed protocol of SSH, see ref. 12.

Northern Hybridization.

Total RNA was isolated by using Trizol (Invitrogen) according to the manufacturer's recommendations. Thirty micrograms of total RNA was separated on a 1.5% agarose formaldehyde gel and transferred to Hybond-N Nylon membrane (Amersham Biosciences). Gene-specific primers were designed for the differentially expressed genes. TCL-1 and TCL-1B probes were amplified by using the following primers: TCL-1-5′ (TGTGGGCCTGGGAGAAGTTCGT), TCL-1-3′ (CCTCCACGCCGTCAATCTTG), TCL-1B-5′ (ATGGCCTCCGAAGCTTCT), and TCL-1B-3′ (GCTGGGTGTGCAAACAGA). After amplification, the PCR products were purified on Sephadex G-50 columns and random labeled with [α-32P]dCTP. The Northern filters were hybridized for 2 h at 65°C in Rapid-hyb buffer (Amersham Biosciences) and washed twice in 2× SSC/0.5% SDS at 65°C and twice in 0.2× SSC/0.5% SDS at 65°C. The membranes were exposed on PhosphorImager for 1–4 days. The radiograms were quantitated by calculating the expression levels in comparison to the β-actin signal.

Agarose Cloning.

Agarose cloning was done as described in ref. 20 with the modification that 0.4% SeaPlaque low-melting-point agarose was used in Iscove's medium containing 10% FCS.

Analysis of Promoter Methylation by Pyrosequencing.

High molecular-weight DNA was isolated by dissolving the cells in lysis buffer (1% SDS/10 mM Tris, pH 8.0/10 mM EDTA, pH 8/200 μg/ml Pronase) at 55°C overnight. The samples were phenol/chloroform extracted, precipitated with a double volume of ethanol, and dissolved in 500 μl of TE buffer (10 mM Tris/1 mM EDTA, pH 7.5). The bisulfite treatment of DNA was performed according to Grunau et al. (21). Briefly, the genomic DNA was denatured by 0.3 M NaOH at 37°C for 20 min. Twelve volumes of bisulfite solution (saturated sodium bisulfite, 0.02 g/ml hydroquinone) was added to the denatured samples and further incubated at 55°C for 4 h. The DNA was purified by QIAquick PCR Purification Kit (Qiagen, Valencia, CA). After bisulfite treatment, nested PCR was performed by using the following primer pairs: TCL-1-bis-out-5′ (AGGTTTATAGGTGGTTTGGGTGG) TCL-1-bis-out-3′ (CCAAAAACTACCACCATTCC), TCL-1-bis-in-5′ (TTTGAGTGTTGGGTATTTGG), TCL-1-bis-in-3′ (ACACAAAACCCTCACTTACC). The PCR was performed in a Rapidcycler (Idaho Technology, Salt Lake City) [50 mM Tris-HCl, pH 8.6/50 μg/ml BSA (Sigma)/3 mM MgCl2/200 μM of each dNTP/0.4 units of Platinum Taq polymerase (Invitrogen)] by using 0.5 μM of the appropriate primers, with the following cycling program: 25 sec at 94°C, followed by 35 cycles of 0 sec at 94°C, 0 sec at 55°C, and 20 sec at 72°C. The final extension was lengthened to 5 min. The first PCR reaction was diluted 5-fold and 1 μl of this was used in the nested PCR using the same conditions for 25 cycles. The extent of methylation was calculated from the conversion rate from C to T as determined by pyrosequencing, which was performed according to this protocol (22) by using sequencing primer (TTT TTA TAT TYG GGT AGT AT).

Immunofluorescence Staining and Image Capturing.

Immunofluorescence and 3D immunofluorescence were essentially done according to ref. 23. Briefly, 105 cells were fixed in 4% freshly prepared paraformaldehyde in PBS. After 10 min of fixation at room temperature (RT), the cells were permeabilized for 5 min in 0.1% Nonidet P-40 in PBS and blocked for 10 min in 10% FCS in PBS. Anti-TCL-1 antibody (clone 27D6/20, Medical and Biological Laboratories, Nagoya City, Japan) 500× diluted in blocking buffer (BB: 5% BSA/10% glycerol/0.2% Tween 20/0.02% NaN3 in PBS) was applied for 2 h at RT. After five washes in PBS, FITC-conjugated rabbit anti-mouse Ig (DAKOPATTS), 20× diluted in BB, was used as a secondary antibody. The 3D immunofluorescence images were generated from the reconstitution of a series of deblurred optical sections according to ref. 23.

Western Blotting.

Western blotting was carried out as described by Pokrovskaja et al. (24). Briefly, ≈2 × 106 cells were lysed in 200 μl of SDS/PAGE loading buffer for 10 min at 95°C. Ten to fifteen microliters of samples were separated in 15% polyacrylamide gel and transferred to a PVDF membrane. After overnight blocking with 5% nonfat dry milk in PBS (PBS-M), the membrane was incubated for 2 h at room temperature with anti-TCL-1 antibody (clone 27D6/20) diluted (1:1,000) in PBS-M to detect TCL-1, washed three times with PBS containing 0.1% Tween 20 (PBS-T), and then reacted for 30 min with horseradish peroxidase-conjugated sheep antibodies to mouse Ig (diluted 1:1,000 in PBS-M). After the second antibody reaction, the filters were washed five times with PBS-T, immersed in the enhanced chemiluminescence solutions (Amersham Biosciences) as specified by the manufacturer, and subjected to autoradiography.

Results

SSH.

A modified SSH was performed to identify EBV-induced genes in BL cells. The EBV-NeoR-infected Akata 17 EBV-NEOR cell line was compared with the EBV-negative Akata 17 cell line as tester and driver, respectively. The subtracted cDNA fragments produced by SSH were cloned into pCR4-TOPO plasmid vector. Six hundred seventy-two independent clones were used to create high-density cDNA arrays that were hybridized with labeled cDNA probes from the EBV-negative Akata- and EBV-NeoR-infected Akata lines, respectively. Forty-four clones that showed the highest difference in expression were sequenced. The majority of the clones represented EBV genes expressed during the lytic cycle (12). The genes that showed the highest level of increased expression are summarized in Table 1. The cell-encoded cDNA that showed the greatest difference with a 5-fold higher expression in the EBV carrying line turned out to be TCL-1, a known human oncogene previously linked to lymphomagenesis.

Table 1.

The result of SSH

Identified genes GenBank accession no. Rel expression
EBV BDLF1 late ORF CAA24836 8.3
EBV BLLF1 (gp340) and BLLF2 HS4GP340A 6.2
EBV BXLF2 late ORF (gp85) CAA24797.1 5.5
TCL-1A XM_046163 5.0
Transcriptional coactivator ALY AF047002 3.8
EBV BKRF3 ORF CAA24818.1 3.7
Deoxycytidine kinase (DCK) XM_003471 3.63
Glutaminyl-tRNA synthetase BC001567 3.63
Lactate dehydrogenase-A HSLDHAR 3.58
EBV BORF2 early ORF CAA24842.1 3.5

TCL-1 Expression in Pairs of EBV-Positive and -Negative BL Lines.

To confirm the DNA array results, Northern hybridization was performed on EBV-negative Akata- and EBV-NeoR-infected Akata cells as well as on the parental EBV-positive Akata line. The original EBV-positive line showed high TCL-1 expression. The loss of the viral genomes decreased the TCL-1 expression 5-fold. Reinfection with the EBV-NeoR virus restored TCL-1 expression to the original level (Fig. 1).

Figure 1.

Figure 1

Northern blot analysis of TCL-1 expression in the EBV-positive and -negative sublines of Akata, Mutu, and OMA BLs.

We have also tested the EBV-positive and -negative sublines of two additional type I BL lines, Mutu and OMA, respectively. The original EBV-positive Mutu I clone 148 expressed TCL-1 at a high level. The EBV-negative Mutu 9 and 30 derivatives were obtained by single-cell cloning of the hydroxyurea-treated EBV-positive parental line (7). TCL-1 expression was almost completely abolished in both negative clones. Reinfection of the EBV-negative Mutu 30 line with the EBV-NeoR virus restored the TCL-1 expression to 60% of the original level. The OMA lines are subcloned derivatives of the EBV-positive OMA BL (25). OMA clone 1 has maintained, whereas clone 4 has lost, the EBV genome (6). The EBV-positive OMA clone 1 showed a 14-fold increase in TCL-1 expression compared with the EBV-negative clone 4. The quantitative evaluation of the expression results is summarized in Table 2.

TCL-1 protein expression was examined by Western blotting (Fig. 2) and immunofluorescence staining (Fig. 3). The BCBL-1 body-cavity lymphoma line that lacks TCL-1 mRNA was used as negative control. Clones that have lost the virus had lower or no TCL-1 protein expression, compared with their original EBV-positive or recombinant Akata virus reconstituted counterparts. To analyze the subcellular distribution of the TCL-1 protein, we generated 3D images that were reconstituted from a series of 15 mathematically deblurred optical sections. These high-resolution pictures showed that TCL-1 was localized to both the cytoplasm and the nucleus and was mainly associated with the cell membrane and the low-DNA-density euchromatic areas, respectively (Fig. 3B).

Figure 3.

Figure 3

(A) Detection of TCL-1 by immunofluorescence staining in EBV-positive original as well as EBV-negative and EBV-reconstituted subclones of Akata and Mutu BLs. EW3 BL and BCBL-1 body-cavity lymphoma lines were used as positive and negative controls, respectively. (B) Stereoprojected image showing the 3D subcellular distribution of TCL-1 protein in EBV-reconstituted Akata 26–43 cells. The images are created from a series of 15 deblurred optical sections 0.3 μm apart. The protein (green, Middle) is mainly associated with the cell membrane and also accumulates in the low DNA density regions of the nucleus (blue, Bottom). (Top) Superposition of TCL-1 staining and DNA.

TCL-1 Expression in Other B Cell Lines.

We have performed Northern hybridization on 18 additional BL lines, four EBV immortalized LCLs, two HHV-8 carrying body-cavity lymphoma lines, a B cell lymphoma line, and freshly isolated tonsil B cells (Table 3). All BL lines and EBV immortalized LCLs expressed TCL-1 from moderate to high levels. Freshly isolated B cells from tonsil expressed TCL-1 at high levels. The two body-cavity lymphoma cell lines, the EBV/HHV-8 double-positive JSC-1, and the HHV-8 single-positive BCBL-1 were completely negative for TCL-1.

Soft-Agar Cloning Assay.

Previous studies by K.T. showed that the BL line Akata that had lost the virus was less clonogenic and tumorigenic in immunodefective mice than the original virus-carrying line (5). We have performed soft-agar cloning assays on three BL pairs with and without EBV. The result of this is shown in Table 4. All soft-agar cloning experiments were repeated three times, and the results are shown as the average colony number ± standard deviation. In the case of the Akata and Mutu lines, 1,000 cells were seeded, whereas 10,000 cells were seeded from the OMA clones. The EBV-containing lines form significantly more colonies than their negative subline.

Table 4.

Soft-agar cloning experiments on EBV-positive and -negative BL pairs

Cell line No. of colonies
Akata clone 17 EBV-NeoR 44  ± 3
Akata clone 17 EBV (−) 15  ± 10
Mutu clone 30 EBV-NeoR 58  ± 15
Mutu clone 30 EBV (−) 24  ± 6
OMA 1 110  ± 2
OMA 4 55  ± 15

Promoter Methylation.

The promoter region of the TCL-1 gene contains methylated CpG sequences in mature (IgM+) B cells and in acute T cell leukemia lines (26). We have tested the methylation status of five CpG sites at and around the NotI site of the TCl-1 promoter by pyrosequencing the bisulfite-treated genomic DNA.

The control BCBL-1 line that does not express TCL-1 showed an average of 40% methylation of the CpG sites, whereas the TCL-1-positive BLs showed no methylation at all. The EBV-positive and -negative Akata and Mutu pairs were completely unmethylated, whereas the EBV-negative OMA 4, but not its EBV-positive counterpart OMA 1, showed 13–15% of methylation.

Locus-Specific Activation of TCL-1 in BLs.

The neighboring TCL-1B gene that is regularly activated in T cell lymphomas with chromosomal translocations and inversions affecting the TCL-1 region (27) remained silent in all BL lines examined by Northern blotting, indicating that the activation is restricted to the TCL-1A locus.

Discussion

Here we show that in originally EBV-positive BLs, the expression of TCL-1 depends on the presence of the virus. Three independently established EBV-positive BL lines down-regulate TCL-1 expression in parallel with the loss of the virus. Reintroduction of EBV into the virus-free clones switched on TCL-1 expression.

Unlike the T cell leukemias, no TCL-1 rearrangements have been found in BLs. T cell leukemia lines that do not express TCL-1, such as Jurkat or CEM, carried a methylated NotI site. Only the EBV-negative OMA clone showed a low-level methylation at these sites. Down-regulation of TCL-1 in EBV-depleted clones is therefore not due to increased methylation. These data indicate that TCL-1 expression in originally EBV-positive BLs is not regulated by either genetic or epigenetic mechanisms. Conceivably, TCL-1 expression might be regulated by EBV in the virus-carrying BLs.

TCL-1 is highly expressed in both EBV-positive and -negative BLs as well as in LCLs (18) in contrast to its lack of expression in the GC progenitor cells (28, 29). Its expression increases during preB cell commitment (30) and its levels are high in pre- and virgin B cells, decreasing at more mature stages of B cell development (29). Recently, transgenic mice that overexpressed TCL-1 in both B and T cells developed Burkitt-like lymphoma with very high penetrance (19). We postulate that TCL-1 activation is a necessary event in the development of the BL phenotype. In EBV-positive BLs, the presence of the virus may be sufficient to induce TCL-1. In virus-negative BLs, the activation may occur during tumor development by a genetic or epigenetic event (Fig. 4). This scenario is in line with the data showing that loss of EBV from the EBV-positive Akata decreases the tumorigenic phenotype (5).

Figure 4.

Figure 4

Suggested contribution of EBV-induced TCL-1 activation to endemic EBV-positive BLs.

All BLs carry an activated c-myc oncogene. Illegitimately expressed c-myc is proapoptotic. In many tumors, constitutive myc expression is paralleled by activation of antiapoptotic programs or the inactivation of proapoptotic pathways. TCL-1 may have antiapoptotic functions, as suggested by its activation of Akt kinase. The high expression of TCL-1 in nonproliferating, but abnormally long-lived, B-CLL cells is also consistent with a possible prosurvival function. Functional analysis revealed its involvement in a PI3-kinase dependent Akt (PKB) prosurvival pathway through its interaction with the Akt kinase (28). TCL-1 protein forms homodimers and its interaction with Akt mediates the formation of oligomeric TCL-1-Akt high-molecular-weight protein complexes in vivo.TCL-1 increases the enzymatic activity of Akt and promotes its translocation to the nucleus (31, 32). Here we show that TCL-1 is partially present in the euchromatic areas of the nucleus in BLs.

We suggest that the activation of TCL-1 by the virus in EBV-positive type I BLs reinforces the antiapoptotic signals, in addition to the known impairment of the p53-dependent apoptotic pathway by ARF deletion, p53 deletion, or HDM2 amplification (33).

Acknowledgments

We thank Monica Pettersson (Pyrosequencing AB) for help with the methylation studies, and Mia Lowbeer, Kenth Andersson, and Melinda Simon for help with B cell isolation and agarose cloning. This work was supported by grants from the Swedish Cancer Society, the Swedish Medical Research Council, the Cancer Society in Stockholm, the Cancer Research Institute/Concern Foundation New York–Los Angeles, and the Karolinska Institute.

Abbreviations

SSH

subtractive suppression hybridization

BL

Burkitt lymphoma

TCL-1

T cell leukemia 1

EBV

Epstein–Barr virus

LCLs

lymphoblastoid cell lines

References

  • 1.Klein G. Cold Spring Harbor Symp Quant Biol. 1975;39:783–790. doi: 10.1101/sqb.1974.039.01.090. [DOI] [PubMed] [Google Scholar]
  • 2.Klein G. BioEssays. 2000;22:414–422. doi: 10.1002/(SICI)1521-1878(200005)22:5<414::AID-BIES3>3.0.CO;2-5. [DOI] [PubMed] [Google Scholar]
  • 3.de-The G, Geser A, Day N E, Tukei P M, Williams E H, Beri D P, Smith P G, Dean A G, Bronkamm G W, Feorino P, Henle W. Nature. 1978;274:756–761. doi: 10.1038/274756a0. [DOI] [PubMed] [Google Scholar]
  • 4.Takada K. Curr Top Microbiol Immunol. 2001;258:141–151. doi: 10.1007/978-3-642-56515-1_9. [DOI] [PubMed] [Google Scholar]
  • 5.Shimizu N, Tanabe-Tochikura A, Kuroiwa Y, Takada K. J Virol. 1994;68:6069–6073. doi: 10.1128/jvi.68.9.6069-6073.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Trivedi P, Zhang Q J, Chen F, Minarovits J, Ekman M, Biberfeld P, Klein G, Winberg G. Oncogene. 1995;11:505–510. [PubMed] [Google Scholar]
  • 7.Chodosh J, Holder V P, Gan Y J, Belgaumi A, Sample J, Sixbey J W. J Infect Dis. 1998;177:1194–1201. doi: 10.1086/515290. [DOI] [PubMed] [Google Scholar]
  • 8.Komano J, Sugiura M, Takada K. J Virol. 1998;72:9150–9156. doi: 10.1128/jvi.72.11.9150-9156.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Takada K, Horinouchi K, Ono Y, Aya T, Osato T, Takahashi M, Hayasaka S. Virus Genes. 1991;5:147–156. doi: 10.1007/BF00571929. [DOI] [PubMed] [Google Scholar]
  • 10.Daibata M, Humphreys R E, Takada K, Sairenji T. J Immunol. 1990;144:4788–4793. [PubMed] [Google Scholar]
  • 11.Shimizu N, Yoshiyama H, Takada K. J Virol. 1996;70:7260–7263. doi: 10.1128/jvi.70.10.7260-7263.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kiss C, Nishikawa J, Dieckmann A, Takada K, Klein G, Szekely L. J Virol Methods. 2003;107:195–203. doi: 10.1016/s0166-0934(02)00233-1. [DOI] [PubMed] [Google Scholar]
  • 13.Virgilio L, Isobe M, Narducci M G, Carotenuto P, Camerini B, Kurosawa N, Abbas-ar-Rushdi, Croce C M, Russo G. Proc Natl Acad Sci USA. 1993;90:9275–9279. doi: 10.1073/pnas.90.20.9275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Virgilio L, Narducci M G, Isobe M, Billips L G, Cooper M D, Croce C M, Russo G. Proc Natl Acad Sci USA. 1994;91:12530–12534. doi: 10.1073/pnas.91.26.12530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Narducci M G, Virgilio L, Isobe M, Stoppacciaro A, Elli R, Fiorilli M, Carbonari M, Antonelli A, Chessa L, Croce C M, et al. Blood. 1995;86:2358–2364. [PubMed] [Google Scholar]
  • 16.Thick J, Metcalfe J A, Mak Y F, Beatty D, Minegishi M, Dyer M J, Lucas G, Taylor A M. Oncogene. 1996;12:379–386. [PubMed] [Google Scholar]
  • 17.Virgilio L, Lazzeri C, Bichi R, Nibu K, Narducci M G, Russo G, Rothstein J L, Croce C M. Proc Natl Acad Sci USA. 1998;95:3885–3889. doi: 10.1073/pnas.95.7.3885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Said J W, Hoyer K K, French S W, Rosenfelt L, Garcia-Lloret M, Koh P J, Cheng T C, Sulur G G, Pinkus G S, Kuehl W M, et al. Lab Invest. 2001;81:555–564. doi: 10.1038/labinvest.3780264. [DOI] [PubMed] [Google Scholar]
  • 19.Hoyer K K, French S W, Turner D E, Nguyen M T, Renard M, Malone C S, Knoetig S, Qi C F, Su T T, Cheroutre H, et al. Proc Natl Acad Sci USA. 2002;99:14392–14397. doi: 10.1073/pnas.212410199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Torsteinsdottir S, Masucci M G, Bejarano M T, Berthold W, Klein E, Klein G. Cell Immunol. 1985;90:65–73. doi: 10.1016/0008-8749(85)90169-8. [DOI] [PubMed] [Google Scholar]
  • 21.Grunau C, Clark S J, Rosenthal A. Nucleic Acids Res. 2001;29:E65. doi: 10.1093/nar/29.13.e65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ronaghi M, Karamohamed S, Pettersson B, Uhlen M, Nyren P. Anal Biochem. 1996;242:84–89. doi: 10.1006/abio.1996.0432. [DOI] [PubMed] [Google Scholar]
  • 23.Holmvall P, Szekely L. Appl Immunochem Mol Morph. 1999;7:226–236. [Google Scholar]
  • 24.Pokrovskaja K, Ehlin-Henriksson B, Kiss C, Challa A, Gordon J, Gogolak P, Klein G, Szekely L. Int J Cancer. 2002;99:705–712. doi: 10.1002/ijc.10417. [DOI] [PubMed] [Google Scholar]
  • 25.Joshi S S, DeBoer J M, Strandjord S J, Pirruccello S J, Sanger W G, Weisenburger D D, Sharp J G. Int J Cancer. 1991;47:643–648. doi: 10.1002/ijc.2910470502. [DOI] [PubMed] [Google Scholar]
  • 26.Yuille M R, Condie A, Stone E M, Wilsher J, Bradshaw P S, Brooks L, Catovsky D. Genes Chromosomes Cancer. 2001;30:336–341. doi: 10.1002/gcc.1099. [DOI] [PubMed] [Google Scholar]
  • 27.Pekarsky Y, Hallas C, Isobe M, Russo G, Croce C M. Proc Natl Acad Sci USA. 1999;96:2949–2951. doi: 10.1073/pnas.96.6.2949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Teitell M, Damore M A, Sulur G G, Turner D E, Stern M H, Said J W, Denny C T, Wall R. Proc Natl Acad Sci USA. 1999;96:9809–9814. doi: 10.1073/pnas.96.17.9809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Narducci M G, Pescarmona E, Lazzeri C, Signoretti S, Lavinia A M, Remotti D, Scala E, Baroni C D, Stoppacciaro A, Croce C M, Russo G. Cancer Res. 2000;60:2095–2100. [PubMed] [Google Scholar]
  • 30.Muschen M, Lee S, Zhou G, Feldhahn N, Barath V S, Chen J, Moers C, Kronke M, Rowley J D, Wang S M. Proc Natl Acad Sci USA. 2002;99:10014–10019. doi: 10.1073/pnas.152327399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Laine J, Kunstle G, Obata T, Sha M, Noguchi M. Mol Cell. 2000;6:395–407. doi: 10.1016/s1097-2765(00)00039-3. [DOI] [PubMed] [Google Scholar]
  • 32.Pekarsky Y, Koval A, Hallas C, Bichi R, Tresini M, Malstrom S, Russo G, Tsichlis P, Croce C M. Proc Natl Acad Sci USA. 2000;97:3028–3033. doi: 10.1073/pnas.040557697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lindstrom M, Wiman K. Semin Cancer Biol. 2002;12:381–387. doi: 10.1016/s1044-579x(02)00058-5. [DOI] [PubMed] [Google Scholar]
  • 34.Trivedi P, Spinsanti P, Cuomo L, Volpe M, Takada K, Frati L, Faggioni A. J Virol. 2001;75:4929–4935. doi: 10.1128/JVI.75.10.4929-4935.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES