TABLE 3.
Mapping of SAGE tags to the 221ESa
| Tag ID no.b | Tag sequence | Annotation | Frequency in:
|
R value | |
|---|---|---|---|---|---|
| 427-221 library | 427-800 library | ||||
| 41524 | CATGTGGTATGTACAAGCTAC | esag6/7c | 44 | 25 | 1.13 |
| 41878 | CATGGGGAACACTGCTGTGCT | esag6 | 32 | 32 | 0.00 |
| 43692 | CATGTAAGGAAACGGCAACAG | Downstream of esag6 | 58 | 45 | 0.34 |
| 63 | CATGATATAAAACGTGGATGC | esag5Ψ | 40 | 45 | 0.07 |
| 87 | CATGAAAATCCTGGGGCAGCA | esag3/3Ψd | 34 | 28 | 0.12 |
| 42811 | CATGTGGGGAGGGGTGACTTT | esag4 | 46 | 38 | 0.16 |
| 42492 | CATGATCTTTTTTTTCTGATT | Hypothetical protein H25N7.21 | 38 | 39 | 0.00 |
| 501 | CATGGAATTGATGTCTCTTCC | esag8/8be | 10 | 2 | 1.25 |
| 41933 | CATGTGCCTTGTGCTTCTTTT | Hypothetical protein H25N7.25 | 15 | 2 | 2.43 |
| 263 | CATGTGCACTGGACTATGAGC | esag8b | 15 | 0 | 4.50 |
| 177 | CATGAAAATCCTGAGGCAGAA | esag3 | 20 | 0 | 6.00 |
| 56 | CATGTGAGGGAGAACTAAAAA | esag1 | 44 | 0 | 13.16 |
Tags are approximately sorted by position on the 221ES (GenBank accession no. AL671259) (Fig. 8). Data presented in bold represent tags with sequences entirely unique to the 221ES. All other tag sequences can be mapped to other known T. b. brucei expression sites but not non-ES locations.
ID, identification.
Tag no. 41524 cannot discriminate between esag6 and esag7 transcripts.
Tag no. 87 maps to both the esag3 pseudogene and the functional esag3 copy in the middle of the ES. It does not map to the terminal copy of esag3.
Tag no. 501 maps to both copies of esag8 as well as to esag8b. As tag no. 263 independently suggests an absence of esag8b transcripts in 427-800, we assume esag8b does not contribute to the frequency of tag no. 501 in 427-800.