TABLE 1.
Bacterial strains, plasmids, and primers
| Strain, plasmid, or primer | Genotype, phenotype, or sequencea | Reference or origin |
|---|---|---|
| E. coli strain | ||
| S17-1 | F−pro thi hsdR recA; chromosome::RP4-2 Tc::Mu Km::Tn7 Tpr Spr | 35 |
| P. aeruginosa strains | ||
| PAO1 | Wild type | ATCC 15692 |
| PAO6281 | gacA::Ω-Sm/Sp; Sm/Spr | 28 |
| PAO6354 | ΔrsmZ | 12 |
| PAO6420 | ΔrsmY | This study |
| PAO6421 | ΔrsmY ΔrsmZ | This study |
| PAO6554 | rsmZ-lacZ transcriptional fusion in mini-Tn7; Gmr | This study |
| PAO6555 | gacA::Ω-Sm/Sp, rsmZ-lacZ fusion in mini-Tn7; Sm/Spr Gmr | This study |
| PAO6556 | ΔrsmY ΔrsmZ, rsmZ-lacZ fusion in mini-Tn7; Gmr | This study |
| PAO6557 | ΔrsmA, rsmZ-lacZ fusion in mini-Tn7; Gmr | This study |
| PAO6558 | rsmY-lacZ transcriptional fusion in mini-Tn7; Gmr | This study |
| PAO6559 | gacA::Ω-Sm/Sp, rsmY-lacZ fusion in mini-Tn7; Sm/Spr Gmr | This study |
| PAO6567 | rsmY ΔrsmZ, rsmY-lacZ fusion in mini-Tn7; Gmr | This study |
| PAO6568 | ΔrsmA, rsmY-lacZ fusion in mini-Tn7; Gmr | This study |
| PAZH13 | ΔrsmA | 26 |
| Plasmids | ||
| pBluescript II SK, KS | Cloning vectors, ColE1 replicons; Apr | Stratagene |
| pME3087 | Suicide vector, ColE1 replicon, IncP-1, Mob; Tcr | 44 |
| pME3087ΔrsmY | pME3087 containing insert of pME3830ΔrsmY | This study |
| pME3280a | Mini-Tn7 gene delivery vector; Gmr | 48 |
| pME3328 | pBluescript II KS containing a 1.43-kb BamHI-XhoI fragment with ′rpoS rsmZ fdxA′; Apr | 12 |
| pME3331 | pME6016 derivative containing a transcriptional rsmZ-lacZ fusion; Tcr | 12 |
| pME3830 | pBluescript II SK containing a 1.3-kb PstI-StuI PCR fragment with ′dnr rsmY and PA0528′, obtained with primers PAOTRR1 and PAOTRR2; Apr | This study |
| pME3830ΔrsmY | pME3830 with a 96-bp deletion in rsmY, obtained by inverse PCR with primers Δ1 and Δ2 | This study |
| pME3843 | pME6010 containing a translational hcnA′-′lacZ fusion under the tac promoter | 25 |
| pME3859 | pME6010 containing a translational rsmA′-′lacZ fusion | 26 |
| pME3897 | pME6182 containing a 3.3-kb BamHI-XhoI fragment of pME3331 with a transcriptional rsmZ-lacZ fusion in the SmaI site of mini-Tn7; Gmr | This study |
| pME3898 | pME6182 containing a 3.3-kb EcoRI-XhoI fragment of pME7311 with a transcriptional rsmY-lacZ fusion in the SmaI site of mini-Tn7; Gmr | This study |
| pME6015 | Cloning vector for translational ′lacZ fusions; pVS1- p15A replicon; Tcr | 33 |
| pME6016 | Cloning vector for transcriptional lacZ fusions, pVS1-p15A replicon; Tcr | 33 |
| pME6182 | Mini-Tn7 gene delivery vector based on pME3280a, HindIII-SmaI-KpnI-NcoI-SphI MCS, ColE1 replicon; Gmr Apr | C. Reimmann |
| pME7311 | pME6016 derivative containing a 216-bp EcoRI-BamHI fragment (amplified with primers PrsmY1 and PrsmY2) carrying the rsmY promoter fused at the putative +5 site to the +1 site of lacZ; Tcr | This study |
| pME7321 | pBluescript II KS containing a 0.85-kb EcoRI-BamHI fragment with the rpsA upstream region and the first eight rpsA codons (amplified with primers PRPSA1 and PRPSA2); Apr | This study |
| pME7322 | pME6015 derivative with a 0.85-kb EcoRI-BamHI rpsA upstream fragment and the first eight codons fused in frame with the ′lacZ gene | This study |
| pUX-BF13 | Helper plasmid containing Tn7 transposition functions, R6K replicon; Apr | 1 |
| Primers (5′ → 3′) | ||
| PAOTRR1 | CTGTTCACTCGAAGCACTCC located in dnr, upstream of the rsmY region | |
| PAOTRR2 | TTCGCCAACTCCGCTATTTC located in PA0528, downstream of the rsmY region | |
| PrsmY1 | TTCCTGGAGCTGGACGGG located in dnr, upstream of the rsmY region | |
| PrsmY2 | CGCAGGATCCTGACGGTTTGAAGATTACGC with a BamHI restriction site (underlined), located in the +1 transcription start region of rsmY | |
| Δ1 | TAGAGATATCCAAAACCCCGCCCAAAAGGC with an EcoRV restriction site (underlined), located upstream of the rsmY terminator | |
| Δ2 | GCGTCTCTACGCATTAGAAGATATCCAGT with an EcoRV restriction site (underlined), located downstream of the rsmY transcription start site | |
| BH1 | ATCATCTTGACGCACGGCAAGC located upstream of rsmY (−148 to −128) | |
| BH2 | TCTGAGCGACGCGGTTTTCC located downstream of the rsmY terminator (+136 to +155) | |
| PRSMZ1 | CTAACAGGGAACACGCAACC, corresponding to the +1 site and the next 20 bp of rsmZ | |
| PRSMZ2 | AAAAAAAGGGGCGGGGTATT located in the terminator of rsmZ | |
| PRPSA1 | AAAAaGGATCCGAGTTCTGCGAAGCTTTCGCTC, with a BamHI restriction site (underlined), located downstream of the first codon of rpsA | |
| PRPSA2 | AAAAAGAATTCCGCGGTCAACCATGGTGTCGAC with an EcoRI restriction site (underlined), located in the cmk gene (PA3163) upstream of rpsA |
a
MCS, multiple cloning site; Apr, ampicillin resistance; Gmr, gentamicin resistance; Smr, streptomycin resistance; Spr, spectinomycin resistance; Tcr, tetracycline resistance; Tpr, trimethoprim resistance.