TABLE 2.
Group-specific rRNA ologinucleotide probes and corresponding washing conditions used in this study
| Target group | Probe namea | Sequence (5′→3′) | Td (°C)b |
|---|---|---|---|
| Universal | UNI1390 | GACGGGCGGTGTGACAA | 44 |
| Bacteria | EUB338 | GCTGCCTCCCGTAGGAGT | 54 |
| Archaea | ARC915 | GTGCTCCCCCGCCAATTCCT | 56 |
| Eukaryotes | EUK1379 | TACAAAGGGCAGGGAC | 42 |
| Gamma/beta proteo- bacteria | BG23S42 | GCCTTCCCACWTCGTTT | 60 |
| S oxidizers (gamma proteobacteria) | GAM660 | TCCACTTCCCTCTAC | 52 |
| Desulfosarcina group | DSS658a | TCCACTTCCCTCTCCCAT | 58 |
| Flavobacteria | CFB319a | TGGTCCGTGTCTCAGTAC | 56 |
| Planctomycetales | PLA927 | CACCGCTTGTGTGAGCCC | 50 |
| Gram-positive bacteria | GB1199 | AGGGGGCATGATG | 34 |
a
Probe sources are from reference 45. Probe GP1199 is specific to most but not all members of the Actinobacteria and Firmicutes; probe PLA927 was designed in this study.
b
All probes were washed at the dissociation temperature (Td) in 1× SSC buffer (0.15 M NaCl, 0.015 M trisodium citrate [pH 7.0] containing 1% sodium dodecyl sulfate, except for probes CF319a and DSS658a which were washed with 1× SSC containing 0.1% sodium dodecyl sulfate.