TABLE 2.
PCR primers and conditions for amplification of intimin alleles
Primerc | Sequence of primer (5′ → 3′) | Target sequence | Reference strain(s) | PCR program | Size of product (bp) | Reference |
---|---|---|---|---|---|---|
SK1 | CCCGAATTCGGCACAAGCATAAGC | Conserved re- gion of eae | 94°C, 30 s; 52°C, 60 s; 72°C, 60 sa,b | 863 | 32 | |
SK2 | CCCGGATCCGTCTCGCCAGTATTCG | EDL933, E2348/69 | ||||
LP2 | CCCGAATTCTTATTTTACACAAGTGGC | eae-α | E2348/69 | 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b | 2,807 | 33 |
LP3 | CCCGAATTCTTATTCTACACAAACCGC | eae-γ | EDL933 | 94°C, 30 s; 48°C, 60 s; 72°C, 90 sa,b | 2,792 | 33 |
94°C, 30 s; 55°C, 60 s; 72°C, 90 sb,e | ||||||
LP4 | CCCGTGATACCAGTACCAATTACGGTC | eae-β | RDEC-1 | 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b | 2,287 | 28 |
LP5 | AGCTCACTCGTAGATGACGGCAAGCG | eae-ɛ | PMK5 | 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b | 2,608 | 28 |
LP6B | TAGTTGTACTCCCCTTATCC | eae-ζ | 4795/95 | 94°C, 30 s; 53°C, 60 s; 72°C, 150 sa,b | 2,430 | This study |
LP7 | TTTATCCTGCTCCGTTTGCT | eae-ι | 7476/97 | 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b | 2,685 | This study |
LP8 | TAGATGACGGTAAGCGAC | eae-η | CF11201 | 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b | 2,590 | This study |
LP10 | GGCATTGTTATCTGTTGTCT | eae-κ | 6044/95 | 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b | 2,769 | This study |
LP11B | GTTGATAACTCCTGATATTTTA | eae-θ | CL-37 | 94°C, 30 s; 50°C, 60 s; 72°C, 150 sa | 2,686 | This study |
94°C, 30 s; 50°C, 60 s; 72°C, 150 sb |
Before the first cycle the sample was denatured for 2 min at 94°C.
After the last cycle, the sample was extended for 5 min at 72°C.
Primer SK1 was used as forward primer in all PCR approaches in combination with SK2, LP2, LP3, LP4, LP5, LP6B, LP7, LP8, LP10, and LP11B.
Three cycles
Twenty-eight cycles.