Skip to main content
. 2002 Dec;40(12):4486–4492. doi: 10.1128/JCM.40.12.4486-4492.2002

TABLE 2.

PCR primers and conditions for amplification of intimin alleles

Primerc Sequence of primer (5′ → 3′) Target sequence Reference strain(s) PCR program Size of product (bp) Reference
SK1 CCCGAATTCGGCACAAGCATAAGC Conserved re- gion of eae 94°C, 30 s; 52°C, 60 s; 72°C, 60 sa,b 863 32
SK2 CCCGGATCCGTCTCGCCAGTATTCG EDL933, E2348/69
LP2 CCCGAATTCTTATTTTACACAAGTGGC eae E2348/69 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b 2,807 33
LP3 CCCGAATTCTTATTCTACACAAACCGC eae EDL933 94°C, 30 s; 48°C, 60 s; 72°C, 90 sa,b 2,792 33
94°C, 30 s; 55°C, 60 s; 72°C, 90 sb,e
LP4 CCCGTGATACCAGTACCAATTACGGTC eae RDEC-1 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b 2,287 28
LP5 AGCTCACTCGTAGATGACGGCAAGCG eae PMK5 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b 2,608 28
LP6B TAGTTGTACTCCCCTTATCC eae 4795/95 94°C, 30 s; 53°C, 60 s; 72°C, 150 sa,b 2,430 This study
LP7 TTTATCCTGCTCCGTTTGCT eae 7476/97 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b 2,685 This study
LP8 TAGATGACGGTAAGCGAC eae CF11201 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b 2,590 This study
LP10 GGCATTGTTATCTGTTGTCT eae 6044/95 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b 2,769 This study
LP11B GTTGATAACTCCTGATATTTTA eae CL-37 94°C, 30 s; 50°C, 60 s; 72°C, 150 sa 2,686 This study
94°C, 30 s; 50°C, 60 s; 72°C, 150 sb
a

Before the first cycle the sample was denatured for 2 min at 94°C.

b

After the last cycle, the sample was extended for 5 min at 72°C.

c

Primer SK1 was used as forward primer in all PCR approaches in combination with SK2, LP2, LP3, LP4, LP5, LP6B, LP7, LP8, LP10, and LP11B.

d

Three cycles

e

Twenty-eight cycles.