TABLE 5.
Insertion sequences present in the xpt PAI of X. nematophilus strains
| Insertion sequence (ORF length, bp) | Homologous insertion sequence, organism (accession no.) | % Identity | Inverted repeata | Direct repeat | Strain(s) in which insertion sequence is present |
|---|---|---|---|---|---|
| IS630-1 (343) | IS630, Shigella flexneri (X05955) | 58 | AAATAAGATTTCAAAATAGT | None | PMFI296 |
| ACAATTATGAAAACTTATTT | |||||
| ISAS-1 (365) | ISAS1, Aeromonas salmonicida (Q44285) | 73 | CAGGGCGCGAGCATACTTT | ACCCTCACCC | L34, QQ2, N38, 0015 |
| ISAS-1p, partial (213) | ISAS1, Aeromonas salmonicida (Q44285) | 70 | CAGGGCGCGAGCATACTTT | NAb | L34, QQ2, N38, 0015, 9965 |
| IS630-2 (343) | IS630, Shigella sonnei (Q8VSK9) | 75 | AATA | TA | 0015, L34, QQ2, N38 |
| IS1328 (327) | IS1328, Shigella flexneri 2a (Q93EZ2) | 79 | None | None | L34, QQ2, N38, 0015, 9965 |
| TnpA-1 (351) | TnpA, Alcaligenes eutrophus (Q7WWT0) | 54 | ATGAACGCGTCCC | None | PMFI296 |
| GGGGCGCGTTCAT | |||||
| TnpA-2 (339) | TnpA, Alcaligenes eutrophus (Q7WWT0) | 58 | ATGAACGCATCCC | None | PMFI296 |
| ISPSY-11 | ISPSY-11, Salmonella enterica serovar Typhimurium | TGTCCCGTCCTAA | ATT | L34, QQ2, N38, 0015 | |
| TCAGGACTAGACA | |||||
| orfA (129) | OrfA (Q8ZQE1) | 66 | |||
| orfB (282) | OrfB (Q8ZQE2) | 64 | |||
| Xis | Photorhabdus luminescens | None | None | L34, QQ2, N38, 0015 | |
| orfA (113) | OrfA (Q7N0B2) | 56 | |||
| orfB (98) | OrfB (Q7NOB1) | 50 |
a
Perfect repeats are only shown once, or both imperfect repeats are shown with differences underlined.
b
NA, not applicable.