TABLE 1.
Oligonucleotide primers and hybridization probes used in this study
| Oligonucleotide | Sequence (5′-3′)a | Gene | GenBank accession no. of reference sequence | Position | Reference |
|---|---|---|---|---|---|
| Leg primer 1 | AGGGTTGATAGGTTAAGAGC | 16S rRNA | M59157 | 451-470 | 8 |
| Leg primer 2 | CCAACAGCTAGTTGACATCG | 16S rRNA | M59157 | 836-817 | 8 |
| Leg probe 1 | GAGTCAACCAGTATTATCTGACCGTCCC-[FL] | 16S rRNA | M59157 | 653-626 | This study |
| Leg probe 2 | [Red 640]GGTTAAGCCCAGGAATTTCACAGATAACTTAATCA-[Ph] | 16S rRNA | M59157 | 624-590 | This study |
| mip FI | GGTCGCTGCAGCTGYCATRR | mip | S62141 | 700-719 | This study |
| mip RI | GCATTAATTGYARWGCTTCAGT | mip | S62141 | 1280-1259 | This study |
| mip FII | GGGGATTSTTTATGAAGATGA | mip | U91607 [S62141] | 467-487 [675-695]c | This study |
| mip RII | ACCAGCAGGCATTAATTGTAA | mip | U91607 [S62141] | 1050-1030 [1288-1268]b,c | This study |
a
[FL], fluorescein; [Red 640], LightCycler-Red 640-N-hydroxy-succinimide ester; [Ph], 3′-phosphate.
b
Four mismatches in this region compared to the mip RII primer.
c
For primer set FII/RII, the corresponding positions in S62141 are given in brackets.