TABLE 2.
Sequence and location of cloned MDV miRNAs and miRNA*s
| Name, sequence (5′-3′) | Length (nt) | No. of readsa | MDV/IRL positionb |
|---|---|---|---|
| MDV-miR-1, UGCUUGUUCACUGUGCGGCA | 20 | 32 | 136873 |
| MDV-miR-2, GUUGUAUUCUGCCCGGUAGUCCG | 23 | 28 | 134232 |
| MDV-miR-2*, CGGACUGCCGCAGAAUAGCUU | 21 | 5 | 134270 |
| MDV-miR-3, AUGAAAAUGUGAAACCUCUCCCGC | 24 | 4 | 134080 |
| MDV-miR-4, UUAAUGCUGUAUCGGAACCCUUC | 23 | 40 | 134368 |
| MDV-miR-4*, AAUGGUUCUGACAGCAUGACC | 21 | 3 | 134405 |
| MDV-miR-5, UGUGUAUCGUGGUCGUCUACUGU | 23 | 12 | 133647 |
| MDV-miR-6, GAGAUCCCUGCGAAAUGACAGU | 22 | 10 | 176052 |
| MDV-miR-7, UCGAGAUCUCUACGAGAUUACAG | 23 | 2 | 175874 |
| MDV-miR-8, GUGACCUCUACGGAACAAUAGU | 22 | 3 | 176164 |
a
Out of a total of 13,679 reads.
b
Identical sequences are located in the TRL and TRS. Numbering is based on AF243438.