TABLE 2.
Primer and probe sequences for real-time PCR detection of serotypes from AdV species C
Primer or probe | Oligonucleotide sequence (5′-3′) | Nucleotide position (hexon gene)a | Concn (μM) |
---|---|---|---|
AdV1 forward | ATACCCAAACTG AAGGCAATCC | 592-614 | 0.4 |
AdV1 probe (reverse) | ACTGAGATTCTCCAACCTGAGGTT | 620-643 | 0.2 |
AdV1 reverse | ACTGAGATTCTCCAACCTGAGGTT | 645-668 | 0.4 |
AdV2 forward | AACCTGTATACGCAGATCCTTCCTA | 607-632 | 0.4 |
AdV2 probe (forward) | AGAACCTCAAATTGGCGAATCTCAGTGGA | 638-667 | 0.2 |
AdV2 reverse | CCTGCCGCATTAGCATCAG | 675-694 | 0.4 |
AdV5 forward | CACTCATATTTCTTACATGCCCACTATT | 890-918 | 0.4 |
AdV5 probe (forward) | AGGAAGGTAACTCACGAGAACTAATGGGCCA | 920-951 | 0.2 |
AdV5 reverse | GGCCTGTTGGGCATAGATTG | 953-973 | 0.4 |
AdV6 forward | AAACCCTGCTATGGCTCATACG | 717-739 | 0.4 |
AdV6 probe (forward) | CCACCAATTCCAACGGCGGACA | 747-769 | 0.2 |
AdV6 reverse | TTTACCATTTTGTTCAACCATAACG | 772-797 | 0.4 |
All primer and probe sequences are located within the most variable region of the hexon gene, starting at nucleotide position 411.