TABLE 2.
Characteristics of direct hybridization oligonucleotide probes for detection of C. tropicalis and S. cerevisiae
| Probea | Species identified | Negative range | Positive range | Minimum ratiob |
|---|---|---|---|---|
| Scrvcld1 | S. bayanus, S. cariocanus, S. cerevisiae, S. kudriavzevii, S. mikatae, S. paradoxus, S. pastorianus | 0-377 | 1554-2288 | 4.1 |
| Saclade2 | S. cerevisiae | NAc | 1115-2672 | NA |
| Trop11 | C. tropicalis, C. ergastensis, C. glucosophila, C. maltosa | NA | 949-2224 | NA |
| Soj9 | C. sojae, C. neerlandica, C. parapsilosis, Candida sp. strain NRRL Y-17456, L. elongisporus, P. triangularis | NA | 1047-1880 | NA |
a
Nucleotide sequences of probes: Scrvcld1, 5′ GACTGCGACGTAAGTCAAGG; Saclade2, 5′ GGACTGAGGACTGCGACGTA; Trop11, 5′ ACAGTTTATCGGGCCAG; Soj9, 5′ ACAGTTTACCGGGCCAG.
b
The minimum ratio is the lowest signal from a positive probe divided by the highest signal detected with a negative probe. A minimum ratio of 2 or greater has been recommended for clear recognition of positive reactions (6).
c
NA, not applicable.