TABLE 1.
Reagents used in this study
| Strain, plasmid, or primer | Genotype or sequence | Source or reference |
|---|---|---|
| Strains | ||
| CM49 | SC5314 wild-type (blood isolate) | 12 |
| CM50 | BWP17, ura3::imm434/ura3::imm434 his1::hisG/his1::hisG arg4::hisG/arg4::his | 55 |
| DAY286 | BWP17, ura3::imm434/ura3::imm434 his1::hisG/his1::hisG arg4::his/ARG4::URA3 | 44 |
| CM149 | ura3::imm434/ura3::imm434 TRP1/TRP1::URA3 | 34 |
| CM152 | ura3::imm434/ura3::imm434 GPR1/gpr1::hisG TRP1/TRP1::URA3 | 34 |
| CM151 | ura3::imm434/ura3::imm434 gpr1::hisG/gpr1::hisG TRP1/TRP1::URA3 | 34 |
| CM150 | ura3::imm434/ura3::imm434 gpa2::hisG/gpa2::hisG TRP1/TRP1::URA3 | 34 |
| CM4 | BWP17, HGT4/hgt4::ARG4 | This study |
| CM9 | BWP17, hgt4::ARG4/hgt4::URA3 | This study |
| CM10 | BWP17, hgt4::ARG4/hgt4::URA3 (independently generated null mutant) | This study |
| CM63 | BWP17, HGT12/hgt12::ARG4 | This study |
| CM64 | BWP17, hgt12::ARG4/hgt12::URA3 | This study |
| CM32 | CM9, his1::hisG/HIS1::pDDB78 | This study |
| CM137 | CM9, his1::hisG/HIS1::pDDB78 +HGT4UTRs only (no coding ORF) | This study |
| CM140 | CM9, his1::hisG/HIS1::pDDB78 +HGT4UTRs only (independent transformant) | This study |
| CM87 | CM9, his1::hisG/HIS1::pDDB78 +wtHGT4(a) | This study |
| CM97 | CM9, his1::hisG/HIS1::pDDB78 +wtHGT4(b) independent transformant | This study |
| CM35 | CM9, his1::hisG/HIS1::pDDB78 +HGT4-1(a) | This study |
| CM36 | CM9, his1::hisG/HIS1::pDDB78 +HGT4-1(b) independent transformant | This study |
| CM170 | CM9, rgt1Δ::FRT/rgt1Δ::FRT | This study |
| YM6870 | MATahis3Δ leu2Δ ura3Δ met15Δ LYS2 rgt2::kanMX::natMX snf3::kanMX | 22 |
| YM7309 | YM6870, plasmid pRS316 (CEN, URA3) | This study |
| YM7311 | YM6870, plasmid pBM3272 (pRS316+RGT2) | This study |
| YM7312 | YM6870, plasmid pBM3272 (pRS316+SNF3) | This study |
| YM7314 | YM6870, plasmid pBM4840 (pRS316+HGT4-RGT2tail) | This study |
| Plasmids | ||
| pBM3212 | pYEp367R + HXT1 promoter-lacZ fusion (2μ ori, LEU2 selection) | 40 |
| pBM4665 | pBME101 (UAU1 cassette) | 10 |
| pBM4671 | pDDB78 (HIS1 complementation, TRP1 selection) | 51 |
| pBM4819 | pDDB78 + HGT4 UTRs only (no coding ORF) | This study |
| pBM4807 | pDDB78 + wild-type HGT4(a) | This study |
| pBM4809 | pDDB78 + wild-type HGT4(b) independent clone | This study |
| pBM4780 | pDDB78 + constitutively signaling (R167K) HGT4-1(a) | This study |
| pBM4782 | pDDB78 + constitutively signaling (R167K) HGT4-1(b) independent clone | This study |
| Primersa | ||
| hgt4::UAU1 | ||
| OM5073 | 5′-AACTAGTGGATCCCCCGGGCTGCAGGAATTCtaaattttgttgacagtttttagcattg | This study |
| OM5076 | 5′-CGGTATCGATAAGCTTGATATCGAATTCatgtaatgggtgtataccctttttatc | This study |
| OM6040 | 5′-CTCGTATAATGTACGATGCTTCATTGGAAGACGAGTATTAggttttcccagtcacgacgt | This study |
| OM6042 | 5′-ACCCCTTCTTGTTCCACCACCACTTCCTCTTCCTCTTCATtgtggaattgtgagcggata | This study |
| hgt12::UAU1 | ||
| OM5075 | 5′-AACTAGTGGATCCCCCGGGCTGCAGGAATTCtccagggattaggtgattatttcag | This study |
| OM5078 | 5′-CGGTATCGATAAGCTTGATATCGAATTCttagcggcctgtaacgggactgaatac | This study |
| OM6331 | 5′-TGAGTGCAAATATCCAAGCTCTtagaaggaccacctttgattgtaaatag | This study |
| OM6332 | 5′-ACTAAAAACTATAAACTGTCATTAgggatttggatggtataaacggaaac | This study |
| hgt4Δ complementation | ||
| OM6132 | 5′-gatatcgaattcctgcagcccgggggatccactagtatgatagtgccacttgtcatcatc | This study |
| OM6133 | 5′-atagggcgaattggagctccaccgcggtggcggccgcaactgcccaatgtaatggagttc | This study |
| OM6134b | 5′-gtcgccaaaatggctgaAaggttcagtggtgtttac | This study |
| OM6135b | 5′-gtaaacaccactgaacctTtcagccattttggcgac | This study |
| RT-PCR | ||
| OM6296 | 5′-cattgtataatggcgaagatcag (HGT4 forward) | This study |
| OM6297 | 5′-cagaatcacttggaggatgagc (HGT4 reverse) | This study |
| OM6298 | 5′-tatggtactcaattcttcaagcg (HGT12 forward) | This study |
| OM6299 | 5′-tcatctctaaatgcgtggacac (HGT12 reverse) | This study |
| OM6474 | 5′-gacgttgatgggcagaatcg (HXT10 forward) | This study |
| OM6475 | 5′-ctgtgtatgtcatggccacc (HXT10 reverse) | This study |
| OM6292 | 5′-aaccaagaatctttgaaagggttg (HGT7 forward) | This study |
| OM6295 | 5′-gaaaactaaacatcccataaagacg (HGT7 reverse) | This study |
| OM6306 | 5′-tgatttggctggtagagacttg (ACT1 forward) | This study |
| OM6307 | 5′-tttgtggtgaacaatggatggac (ACT1 reverse) | This study |
a
Uppercase letters indicate sequences used during gap-repair cloning. Lowercase letters indicate sequences used during PCR amplification.
b
The uppercase letter indicates the mutation encoding the R167K missense.