TABLE 2.
Probes used for FISH and the corresponding hybridization and washing conditions
Probe | Sequence (5′→3′) | Target organisms | Conca
|
Competitor | Reference | |
---|---|---|---|---|---|---|
Formamide (%) | NaCl (M) | |||||
EUB338 | GCTGCCTCCCGTAGGAGT | Bacteria | 0 | 0.9 | 1 | |
EUB338II | GCAGCCACCCGTAGGTGT | Bacteria | 0 | 0.9 | 4 | |
EUB338III | GCTGCCACCCGTAGGTGT | Bacteria | 0 | 0.9 | 4 | |
NEU | CCCCTCTGCTGCACTCTA | Halophilic and halotolerant members of the genus Nitrosomonas | 40 | 0.056 | CTE | 41 |
Ntspa662 | GGAATTCCGCGCTCCTCT | Nitrospira genus | 35 | 0.08 | CNtspa662 | 5 |
NmII | TTAAGACACGTTCCGATGTA | Many members of the Nitrosomonas communis sublineage | 25 | 0.159 | 26 | |
Nsv443 | CCGTGACCGTTTCGTTCCG | Most Nitrosospira spp. | 30 | 0.112 | 23 | |
Nso1225 | CGCCATTGTATTACGTGTGA | Almost all ammonia-oxidizing β-Proteobacteria | 35 | 0.08 | 23 | |
Nso190 | CGATCCCCTGCTTTTCTCC | Many but not all ammonia-oxidizing β-Proteobacteria | 50 | 0.028 | 23 | |
Nmo218 | CGGCCGCTCCAAAAGCAT | Many members of the Nitrosomonas oligotropha sublineage | 35 | 0.08 | 10 | |
NmV | TCCTCAGAGACTACGCGG | Nitrosococcus mobilis | 35 | 0.08 | 26 | |
Nit3 | CCTGTGCTCCATGCTCCG | Nitrobacter | 40 | 0.056 | CNIT3 | 42 |
CNIT3 | CCTGTGCTCCAGGCTCCG | Competitor to Nit3 | 42 | |||
CTE | TTCCATCCCCCTCTGCCG | Competitor to NEU | ||||
CNtspa662 | GGAATTCCGCTCTCCTCT | Competitor to Ntspa662 |
Concentrations presented as percentage of formamide in hybridization buffer or molar concentration of NaCl in wash buffer.