TABLE 2.
Oligonucleotide | Oligonucleotide sequence (5′→3′)a | Locationb | Use |
---|---|---|---|
PUTA004 | CATGAATTCCTCCTTATGCGTTCTCAGTC | putA | Amplification of putA gene |
PUTA005 | ACTCTAGATTCGGGGATGAGATTGAGGAAA | putA | Amplification of putA gene |
PUTA0012 | GAGATCAATGCCCATAGCTTATCGAGC | putA | Identification of transcription start sites |
PUTP004 | GTGGATCCAAGATTACTCTAGCTCAACCA | putP | Amplification of putP gene |
PUTP005 | GCGCTGCAGTCTAATGAGGACTATCTAATGA | putP | Amplification of putP gene |
Regions of oligonucleotides not complementary to the corresponding genes are underlined.
Location to where the nucleotides are hybridized.