TABLE 1.
Oligonucleotide primers
| Purpose | Primera | Sequence (5′ to 3′)b | Locationc | 5′ Tag site |
|---|---|---|---|---|
| sloΔ1 construction and confirmationd | MF01 (F) | AGCGGGATAACAATTTCACACAGG | pUC18 500 to 478 | |
| MF02 (R) | CGCCAGGGTTTTCCCAGTCACG | pUC18 352 to 373 | ||
| MF03 (R) | gggggtaccGGGTCATTGACCTCAACCGTTGC | slo 637 to 659 | KpnI | |
| MF04 (F) | gggggtaccGAAGGTGATGATTGCAGCATAC | slo 870 to 891 | KpnI | |
| MF05 (F) | GCGCATTATTAGAGAGGCTATGG | slo −126 to −104 | ||
| MF06 (R) | CAAAATTTTCAATGGTTTCACC | slo 382 to 403 | ||
| sagBΔ1 construction and confirmationd | JJ029 (F) | aaggaattcATGTCATTTTTTACAAAGGA | sagB 1 to 20 | EcoRI |
| JJ030 (R) | aagttctcgagTCATTGAGACTCCTTAGTT | sagB 951 to 933 | XhoI | |
| JJ055 (F) | cacaagcttAACGTTAGAGATTTTG | sagB 652 to 667 | HindIII | |
| JJ056 (R) | gcgaagcttGTAACTACTTGAAAAA | sagB 300 to 285 | HindIII | |
| JJ051 (F) | ataaagcttTATACGCCAGGTAAATA | sagB −239 to −223 | HindIII | |
| JJ060 (R) | gagatcgatTTCAAGATTGTAGTCATC | sagB 1138 to 1121 | ClaI | |
| PCR amplification of hybridization probes | sagA (F) | AATTGAGCTAGCCTTGTCCTTG | sagA −107 to −85 | |
| sagA (R) | TTTACCTGGCGTATAACTTCC | sagA 159 to 139 | ||
| emm5 (F) | AGGCCCTTAATGAACTCTTG | emm5 476 to 495 | ||
| emm5 (R) | CCTGCTTGTGGTGCTTGAC | emm5 1217 to 1198 | ||
| ska (F) | TGATCGAAACGGCAAGGTCTA | ska 408 to 428 | ||
| ska (R) | ACGGTTATGATACGGTTGGTG | ska 1178 to 1158 | ||
| speB (F) | CTTATGCTGGTACCGCTGAGA | speB 410 to 430 | ||
| speB (R) | TCCGCCTACTTTACCGACACC | speB 1017 to 997 | ||
| recA (F) | TCTTCCGGTAAAACGACTGTG | recA 88 to 108 | ||
| recA (R) | GGCGGAGCGACCTTGTTTTTA | recA 656 to 636 | ||
| 39-M5 (F) | GGTTCTGATAATACAGGACC | sagA −430 to −411 | ||
| 40-M5 (R) | GATTAATATGTAAACCCTTTC | sagA −166 to −186 |
F, forward; R, reverse.
Some primers were synthesized with additional 5′ sequence tags (lowercase letters) to incorporate particular restriction endonuclease cleavage sites (underlining) (as specified in the last column).
For MF001 and MF002, which correspond to pUC18 vector lacZ sequences flanking the cloned slo gene in plasmid pMK206 (42), positions indicated are relative to nucleotide 1 of the pUC18 vector sequence (62). For all other primers, positions indicated are relative to the translation start sites of the specified GAS genes, with negative numbers indicating flanking upstream sequences. GAS gene sequences were obtained from serotype M5 strain Manfredo genome sequence data published at The Sanger Centre website (www.sanger.ac.uk/Projects/S_pyogenes/).
Only primers specified in the text are shown. Additional sequencing primers were omitted to save space.