TABLE 1.

Sequences of wild-type or mutated YY1 DNA-binding sites

Name	Sequencea (5′-3′)	muIFN-β promoter position
Consensus	GA(C/g/a)(G/t)(C/a/t)CATN(T/a)(T/g/c)
32	GCAGAAAGGACCATCCCTTATA	−32 coding strand
32G	GCAGAAAGGgCCATCCCTTATA	−32 coding strand
32T	GCAGAAAGGACCATCttTTATA	−32 coding strand
32GT	GCAGAAAGGgCCATCttTTATA	−32 coding strand
90	TTTTCCTCTGTCATTTTCTCTT	−90 noncoding strand
mut90	TTTTCCTCTGTaATTTTCTCTT	−90 noncoding strand
122	CTTCTAATATTCATTTTATTCA	−122 noncoding strand
mut122	CTTCTAATATTgATTTTATTCA	−122 noncoding strand
122G	CTTCTAATAgTCATTTTATTCA	−122 noncoding strand
161	TTAACCCAGTACATAGCATATA	−161 coding strand

^aIn the consensus sequence as defined by Hyde-DeRuyscher et al. (12) uppercase letters represent the preferred nucleotides and lowercase letters represent nucleotides tolerated to a lesser extent. Boldface letters indicate the nucleotides corresponding to the YY1 core motif. Underlining indicates the nucleotides present outside the core motif characterized as important for binding affinity and specificity. Lightface lowercase letters in the muIFN-β sites indicate mutations introduced in the sequence of the potential YY1-binding sites.