Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Composition of 35-bp sequences
| Name | Nucleotide Sequence | % A | % T | % G | % C |
|---|---|---|---|---|---|
| T1 | CAAATTTAGGTTGCTTTGGCATGATCTATTTTTTT | 20.0 | 51.4 | 17.2 | 11.4 |
| T1a | CAAATTTAGGTTGCTTTGGCAAGATCTATTTTTTT | 22.8 | 48.6 | 17.2 | 11.4 |
| T2 | TTTTTTGTTCTTTTACTACGAAAAGCATCTTCTTG | 20.0 | 51.4 | 11.4 | 17.1 |
| T3 | GGTGGCAACTGTTTTGCTATAAGATTCCATGTGTT | 20.0 | 40.0 | 25.7 | 14.3 |
T1, T2, and T3 are 35-bp sequences contained within the Sh1 first intron. T1a is a derivative of T1 and has a single base change indicated by the underline.
