Figure 4.

RT-PCR analysis of IRF-1 expression during P. aeruginosa infection. The relative ratios of IRF-1 transcripts from the time-course analysis (A) as well as adherence-mediated activation (B) were determined in serum-free and serum-supplemented culture media. To verify the differential regulation of IRF-1 during infection by P. aeruginosa, we used RT-PCR as described in Materials and Methods. Multiplex PCR were accomplished by using an IRF-1-specific [TCCACCTCTCACCAAGAACC and AAGTCCAGCTTCTCTGCACC] primer pair along with QuantumRNA 18S primer/competimer mix (Ambion). The relative ratios of IRF-1 levels were normalized to the 18S rRNA standard.