Table 2.

Polymerase chain reaction (PCR) and sequencing primers used in this study

Application	Primer	Direction	Position*	Sequence (5′–3′)	Ref
PCR/sequencing	TPU1	Forward	8–27*	AGAGTTTGATCATGGCTCAG	von Wintzingerode78
Sequencing	TPU2	Forward	334–53*	CCAGACTCCTACGGGAGGCA	von Wintzingerode78
Sequencing	M13 (20)	Forward	389–404†	GTCGTGACTGGGAAAAC	Guttman79
Sequencing	M13 (40)	Reverse	205–21†	AACAGCTATGACCATG	Guttman79
Sequencing	TPU5	Forward	906–26*	AAACTCAAATGAATTGACGG	von Wintzingerode78
Sequencing	1000R	Reverse	1100–15*	GGGTTGCGCTCGTTGC	von Wintzingerode78
PCR/sequencing	RTU8	Reverse	1522–41*	AAGGAGGTGATCCAACCGCA	von Wintzingerode78
SSCP/sequencing	Com1	Forward	519–36*	CAGCAGCCGCGGTAATAC	Schwieger52
SSCP/sequencing	Com2-Ph‡	Reverse	907–26*	CCGTCAATTCCTTTGAGTTT	Schwieger52

*Position referring to the Escherichia coli reference sequence.

†M13 priming sites on pCR 2.1 plasmid vector.

‡Com2-Ph contained a 5′ terminal phosphate group.

SSCP, single strand conformation polymorphism.