Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers for quantitative PCR (probes labelled 5′ FAM, 3′ TAMRA)
| TLR2: | forward: | acgacgccttcgtgtcctac |
| reverse: | gctcctggaccatgaggtttc | |
| probe: | cgagcgggattcctactgggtgg | |
| TLR4: | forward: | tggaggacatgccagtgct |
| reverse: | caccgacacactgatgatcgt | |
| probe: | agtttcaggaacgccacttgtcagctg |
