Figure 1.
PAGE of RNA digested by the ZFY-6 peptide dimer. The (UGGUGGGCGCCGUCGGUGUGGGCAA) RNA substrate was incubated in the absence of ZFY-6 peptide (lane 1) for 60 min and with ZFY-6 peptide (lane 2–6) for 5–40 min.
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.