Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Ionic dependence on RNA cleavage by the dimeric form of the ZFY-6 peptide. Cleavage reactions were prepared with 500 nM (UGGUGGGCAAUGGGCGUGUU) RNA and 100 nM ZFY-6 peptide. The percent RNA cleaved is equal to [product]/[total substrate] × 100 after 60 min. (A) RNA cleavage activity of the ZFY-6 peptide as a function of NaCl concentration. (B) RNA cleavage activity in the presence of either Mg2+ (filled bars) or Mn2+ (hatched bars).
