Table 1 Frequency of PTPN22*R620W genotypes in all patients with SSc and in patients with SSc with autoantibodies (anti‐topoisomerase I and anti‐centromere) and in controls.
| PTPN22*R620W genotype | Patients with SSc (n = 121) | Patients with SSc with anti‐topoisomerase I antibodies (n = 30) | Patients with SSc with anti‐centromere antibodies (n = 20) | Controls (n = 103) | p Value |
|---|---|---|---|---|---|
| R/W and W/W | 16 (13) | 4 (13) | 0 (0) | 18 (17) | 0.38* |
| R/R | 105 (87) | 26 (87) | 20 (100) | 85 (83) | 0.99† |
| R/W | 15 (12) | 4 (13) | 0 (0) | 17 (16) | 0.12‡ |
| W/W | 1 (1) | 0 (0) | 0 (0) | 1 (1) |
Values are n (%).
PTPN22, protein tyrosine phosphatase non‐receptor 22; SSc, systemic sclerosis.
PTPN22*R620W genotyping was carried out by polymerase chain reaction‐restriction fragment length polymorphism analysis. Sense and anti‐sense primers were 5′‐GATATGTTGCTTCAACGGAATTT‐3′ and 5′‐CCATCCCACACTTTATTTTATACT‐3′, respectively. The PTPN22‐1858C/T transition eliminates an RsaI restriction site. The results were confirmed using XcmI, for which a restriction site is created in the 1858T allele. Allele and genotype frequencies were compared with the χ2 test. Differences were considered significant if p<0.05.
*Comparison between patients with SSc and controls.
†Comparison between patients with SSc with anti‐topoisomerase I antibodies and controls.
‡Comparison between SSc patients with anti‐centromere antibodies and controls.