Figure 5.

EMSA of three putative TF binding sites form DNA–protein complexes in neocortical and fibroblast nuclear extracts. Neocortical (NEO) and fibroblast (FIB) nuclear extracts from E18 rat embryos were incubated with three ³²P-radiolabeled probes from human A4 and D receptor subunits. Cold wild-type oligonucleotides were used to define specificity through competition. Cold oligonucleotides were added at 100-fold excess over probe. The conditions for each lane are as indicated. Specific binding complexes are shown using asterisks (*). The probe sequences are as follows: (A) GABA-A4: AGCGCGGGCGAGTGTGAG CGCGAGTGTGCGCACGCCGCGGG, (B) GABA-A4: GTGCACACACACGCCCACC GCGGCTCGGG and (C) GABA-D: TGACCGTAGTAGA.