Double-stranded oligonucleotide functional assay for GABRA4 regulation. Primary cultures of rat neocortical neurons were treated with DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate) alone (Mock) or with DOTAP and phosphothioate oligonucleotides from either a cAMP response element (CRE Decoy) or a sequence from the GABA-A4 promoter predicted using positional clustering (GABA-A4 Decoy) (GTGCACACACACGCCCACCGCGGCTCGGG). mRNA was harvested after 24 h, and real-time RT–PCR was performed with GABA-A4 specific primers. Error bars refer to individual experiments; i.e. different platings of cells from different animals. Data was normalized to rRNA levels, and expressed as relative mRNA levels (GABA-A4/rRNA). Results are shown as mean ± SEM, N = 3, asterisk indicates significantly different from control at the 95% confidence interval.