TABLE 1.
Bacteria, plasmids, and primers used in this study
| Bacterium, plasmid, or primer | Description or sequencea | Reference or source |
|---|---|---|
| Bacteria | ||
| Pseudomonas aeruginosa | ||
| PAO1 | Wild type | Hiroshima University, Japan, via J. Kato |
| PAO1sodM | Mn-SOD mutant of PAO1; sodM::Ωaac Gmr | This study |
| PAO1sodB | Fe-SOD mutant of PAO1; sodB::ΩTcTcr | This study |
| PAO1sodMB | SOD double mutant of PAO1; sodM::Ωaac sodB::ΩTc Gmr Tcr | This study |
| Escherichia coli | ||
| DH5α | F−recA1 endA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1 Δ(lacZYA-argF)U169 λ− (φ80dlacZΔM15) | 25 |
| S17-1 | thi pro hsdR recA; chromosomal RP4; Tra−; Tpr Sm/Spr | 29 |
| Plasmids | ||
| pGEM-T Easy | PCR cloning vector; AmprlacZ f1 ori/ori | Promega |
| pBBR1MCS2 | Broad-host-range vector; Kmr | 22 |
| pK18mobsacB | Allelic-exchange suicide vector; KmrsacB oriT (RP4) lacZ | 27 |
| pHP45Ωaac | Source of gentamicin resistance cassette; Ampr Gmr | 3 |
| pHP45ΩTc | Source of tetracycline resistance cassette; Ampr Tcr | 11 |
| pGSodM | 3.0-kb sodM fragment in pGEM-T Easy | This study |
| pGSodB | 1.1-kb sodB fragment in pGEM-T Easy | This study |
| pSodM | 3.0-kb sodM fragment in pBBR1MCS2 | This study |
| pSodB | 1.1-kb sodB fragment in pBBR1MCS2 | This study |
| pGSodM5′ | 2.5-kb fragment of 5′ sodM in pGEM-T Easy | This study |
| pGSodM3′ | 0.5-kb fragment of 3′ sodM in pGEM-T-Easy | This study |
| pGSodB5′ | 0.5-kb fragment of 5′ sodB in pGEM-T Easy | This study |
| pGSodB3′ | 0.7-kb fragment of 3′ sodB in pGEM-T Easy | This study |
| pGSodMHind | 3.0-kb sodM fragment containing HindIII site in pGEM-T Easy | This study |
| pGSodBHind | 1.1-kb sodB fragment containing HindIII site in pGEM-T Easy | This study |
| pGSodMΩaac | 2.9-kb mutated sodM fragment in pGEM-T Easy | This study |
| pGSodBΩTc | 3.3-kb mutated sodB fragment in pGEM-T Easy | This study |
| pKSodM | 2.9-kb mutated sodM fragment in pK18mobsacB | This study |
| pKSodB | 3.3-kb mutated sodB fragment in pK18mobsacB | This study |
| Primers | ||
| sodMf(−2350) | TTCAATTGTCCGCCTCTAT | This study |
| sodMr626 | CATCACGGGTAACACTAGG | This study |
| sodMf133HindIII | GCGAAGCTTGGCACGCCCTATGC | This study |
| sodMr124HindIII | CTTAAGCTTCGGCGTTCAGGTTGT | This study |
| sodBf(−346) | CGCGGTTTCTGTCTTC | This study |
| sodBr760 | GGCCTTCCTTGTTCGT | This study |
| sodBf110HindIII | CCTAAGCTTTGAACCTGAACAACCTGA | This study |
| sodBr109HindIII | TCAAAGCTTCCACGTAGGTGTTGTGGT | This study |
a
Abbreviations for phenotype: Ampr, ampicillin resistance; Gmr, gentamicin resistance; Spr, spectinomycin resistance; Smr, streptomycin resistance; Tpr, trimethoprim resistance.