Table 2.

Loci corresponding to the ten most abundant MPSS signatures unique to one or more of the NIDCD mouse inner ear libraries.

signature abundance in tpm (transcripts per million)
Signature	Locus	Description	MoVB	MoCR	MoSV
GATCGAGGACATGGCCAGAA	Otos	Otospiralin, mouse mutant is deaf [41]	592	9,212	2,229
GATCCGGCTACACTGCACTC	Gm741	novel, Vmo1 (gene model 741)	218	4,650	171
GATCCTCAAACCCAGCCCTT	Tecta	alpha-tectorin, major component of tectorial membrane; mutations in human TECTA cause hearing loss (DFNA8, DFNA12, DFNB21) [42,43]	489	2,737	0
GATCCCCTCCTTTCTGCACT	Otog	Otogelin, inner ear specific glycoprotein, mouse mutant (twister) is deaf [44]	1,832	1,105	4
GATCTTCTAACCCTTCAAAA	Col9a3	Mutations in human COL9A3 cause progressive hearing loss [45]	1,649	1,194	1,431
GATCTCAGATTATTCATTCA	Col9a1	Mouse KO causes progressive deafness [46]	476	183	1,398
GATCTGCAGAGATTATTGCC	Oc90	Otoconin, 90% of otoconia mass [47]	1216	572	123
GATCTGTTTGCGGGAGTAGA	Tectb	Beta-tectorin, major component of the tectorial membrane, [48]	4	819	15
GATCCTGCGAGCTCCAGACT	Cib3	Calcium and integrin binding family member 3 (predicted), function unknown	675	0	0
GATCACGGGGCCTTGGAAAA	Otoa	Otoancorin, mutations in human OTOA cause autosomal recessive deafness, DFNB22 [49]	379	296	0

Signatures >3 tpm in at least one inner ear library, <4 tpm in any MRT library, and are class 1–6. Signatures identifying alternate 3′ ends of genes already listed in the table are omitted, i.e. there are two signatures each for Otos and Col9a1 that would rank in the top ten for abundance.