TABLE 2.
Primers used in this study
| Primer | Sequence | Description |
|---|---|---|
| d3 | GGTCACTTGTTGGCGGCG | Amplification of partial sequences of IS1237 |
| d4 | CGAGCGCGGTGATCGTTG | Amplification of partial sequences of IS1237 |
| d5 | GAGGTGGTTTCAGTAGTC | Amplification of IS1237 from L. xyli subsp. cynodotis chromosome |
| d12-5′ | GTCCCATGGCGACGCTGGCTG | Amplification of the IS1237 transposase gene |
| d12-3′ | CCCAAGCTTGTTTACCCAGTC | Amplification of the IS1237 transposase gene |
| d13 | GGACCTAACCCCACGGATC | Amplification of downstream flanking sequence of IS1237 in L. xyli subsp. cynodotis chromosome |
| d14 | CTCGTGGAACCTGTGTTAGAC | Amplification of downstream flanking sequence of IS1237 in L. xyli subsp. cynodotis chromosome |
| d15 | CTCGTCGCTCTAGCAATCG | Amplification of downstream flanking sequence of IS1237 in L. xyli subsp. cynodotis chromosome |
| d16 | CACTTACGGAGTCCAGGCAG | Amplification of upstream flanking sequence of IS1237 in L. xyli subsp. cynodotis chromosome |
| d17 | CCGCTTCGGACCATTCACGC | Amplification of upstream flanking sequence of IS1237 in L. xyli subsp. cynodotis chromosome |
| d18 | CACAACATATCCGTAATGAACCG | Amplification of upstream flanking sequence of IS1237 in L. xyli subsp. cynodotis chromosome |
| d48 | CGGCCATGGTGTGGGAGC | Construction of the mutant transposase gene |
| d49 | CGTGGAGAGAGCTCCC | Construction of the mutant transposase gene |
| d50 | GGGAGCTCTCTCCACG | Construction of the mutant transposase gene |
| d51 | TAAAAGCTTGTTTCAGTAGTCGTT | Construction of the mutant transposase gene |
| AMP1 | AAGGGATCCGTGATACGCC | Amplification of the ampicillin resistance gene |
| AMP2 | GAAGGATCCTCACCTAGATC | Amplification of the ampicillin resistance gene |
| Tn5564-p1 | ACATCAACGGCCCGGAATAC | Amplification of the ISLxc2 sequence |
| Tn5564-p2 | GCAACAGCCTCTCGTGGGAC | Amplification of the ISLxc2 sequence |
| Tn5564-p3 | ACTGGAACAAGGCGAGAGGGAC | Amplification of the ISLxc2 sequence |
| Tn5564-p4 | CATAAGGCCCGGCAACTACA | Amplification of the ISLxc2 sequence |
| Tn5564-p5 | CAGGGTGCTCTCCGACAACG | Amplification of the ISLxc2 sequence |
| Tn5564-p6 | CAGGGAGAGCGGAACAAGGTC | Amplification of the ISLxc2 sequence |
| AD1 | NTCGA(G/T)T(A/T)T(G/C)G(A/T)GTT | Arbitrary degenerate primer |
| AD2 | NGTCGA(G/C)(A/T)TGANA(A/T)GAA | Arbitrary degenerate primer |
| AD3 | (A/T)GTGNAG(A/T)ANCANAGA | Arbitrary degenerate primer |
| AD4 | AG(A/T)GNAG(A/T)ANCA(A/T)AGG | Arbitrary degenerate primer |
| GUS7 | CCACACTTTGCCGTAATG | RT-PCR primer for the GUS gene |
| GUS8 | CACAAACGGTGATACGTAC | RT primer for the GUS gene |
| AAP | GGCCACACATCGACTAGTACGGGIIGGGIIGGGII | 5′ RACE abridged anchor primer |
| AUAP | GGCCACGCGTCGACTAGTAC | Abridged universal amplification primer |
| Pu1 | ACAACCACCGCCACGC | RT-PCR primer for Pu |
| Pu2 | CCGCTAACCAGCCACAA | RT-PCR primer for Pu |
| Pd1 | CTGAAACCACCTCATCTC | RT-PCR primer for Pd |
| Pd2 | CAAAAACGACTACTGAAAC | RT-PCR primer for Pd |