TABLE 2.
Oligonucleotides used in this study
| Oligonucleotidea | Sequence (5′-3′) | Usage | 
|---|---|---|
| E54.1 | AATGGTATGTTCAATGACC | Expression | 
| E54.2 | AGAAGCACGCGAACAAGCA | Expression | 
| E54.3 | TCTGCTTGTTCGCGTGCTT | Expression | 
| E54.4 | CACCATTCACACTTCCAGA | Expression | 
| E54.5 | CATGCTGACAGCAAAGTCA | Expression | 
| Eh54.1 | GTCGGAGGAATGAAGAGT | Disruption | 
| Eh54.3 | GTTGACGAGCTTGTTCTG | Disruption | 
| sagAup | CGGAATTCGAAATGCTAGACTTAACGC | Complementation | 
| sagAdown | CGGAATTCGCAAGCAGGTATCGACATG | Complementation | 
E54.1 and E54.5 were used to express the full-length SagA (F). E54.1 and E54.3 were used to express the N-terminal domain of SagA (N). E54.1 and E54.4 were used to express the N-terminal half of SagA (containing the N-terminal and middle domains [NM]). E54.2 and E54.4 were used to express the middle (repeat) domain of SagA (M). E54.2 and E54.5 were used to express the C-terminal half of SagA (containing middle and C-terminal domains [MC]). Letter codes correspond to lane designations in Fig. 5.