Table 1.
Real-time PCR primers, hybridization probes and LightCycler conditions for the genotyping of the CYP2C9*2 and CYP2C9*3 variant alleles.
| Variant allele | Reagents | Per sample |
|---|---|---|
| CYP2C9*2/CYP2C9*1 | PCR primer | |
| 5′- CACTGGCTGAAAGAGCTAACAGAG −3′a | 0.5 µm | |
| 5′- GTGATATGGAGTAGGGTCACCCAC −3′a | 0.5 µm | |
| Hybridization probes | ||
| 5′- CATTGAGGACCGTGTTCAAGAGGAA- FL−3′(sensor) | 0.2 µm | |
| 5′- LCR640– CCCGCTGCCTTGTGGAGGAGTTGAG 3′(anchor) | 0.2 µm | |
| MgCl2 | 3 mm | |
| FastStartDNA | 2 µl | |
| Genomic DNA | 60 ng | |
| Initial denaturation 95 °C for 10 min | ||
| Amplification (45 cyles) | ||
| Denaturation 95 °C for 5 s | ||
| Annealing at 67 °C for 10 s | ||
| Extension at 72 °C for 15 s | ||
| Melting curve analysis by heating 0.2 °C s−1 from 40 °C to 85 °C. | ||
| CYP2C9*3/CYP2C9*1 | PCR primer | |
| 5′- AGGAAGAGATTGAACGTGTGA- 3′a | 0.5 µm | |
| 5′- CCTTGGGAATGAGATAGTTTCTGAA- 3′ | 0.5 µm | |
| Hybridization probes | ||
| 5′- CCAGAGATACCTTGACCTTC- FL−3′ (sensor) | 0.2 µm | |
| 5′- LCR640– CCCACCAGCCTGCCCCATGC −3′ (anchor) | 0.2 µm | |
| MgCl2 | 4 mm | |
| FastStartDNA | 2 µl | |
| Genomic DNA | 40 ng | |
| Initial denaturation 95 °C for 10 min | ||
| Amplification (50 cyles) | ||
| Denaturation 95 °C for 5 s | ||
| Annealing at 58 °C for 10 s | ||
| Extension at 72 °C for 5 s | ||
| Melting curve analysis heating 0.2 °C s−1 from 40 °C to 85 °C. |
The fluorescein-labelled (FL) oligonucleotide probes (sensor) laying over the polymorphism sites were designed to recognize the wild-type sequence in CYP2C9*2 assay and the mutated sequence in CYP2C9*3 assay.The acceptor hybridization probe (anchor) is labelled at the 5’-end with a LightCycler-Red fluorophore (LCR640).
a
The primers were adapted from PCR-RFLP method as described by Aynacioglu et al. [7].