Skip to main content
. 2007 Feb 22;35(6):e45. doi: 10.1093/nar/gkm047

Table 1.

Summary of In-Fusion™ site sequences and characteristics of the pOPIN vectors presented in this article

Vector Fusion tag Parent vector/ antibiotic resistance Promoters/baculoviral recombination sites Forward primer extension Reverse primer extension
pOPINE C-terminal … KHHHHHH pTriEx2/ampicillin T7lacO, CMV enhancer and β-actin promoter, p10 promoter/ lef-2 and 1629 baculo elements. AGGAGATATACCATG† GTGATGGTGATGTTT†
pOPINF* N-terminal MAHHHHHHSSGLEVL FQInline graphicGP … pTriEx2/ampicillin T7lacO, CMV enhancer and ββ-actin promoter, p10 promoter/ lef-2 and 1629 baculo elements. AAGTTCTGTTTCAGGGCCCG‡ ATGGTCTAGAAAGCTTTA‡
pOPING N-terminal MGILPSPGMPALLSLV SLLSVLLMGCVAInline graphicET G … cleavable secretion leader and C-terminal … KHHHHHH pTriEx2/ampicillin (T7lacO-not used), CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements. GCGTAGCTGAAACCGGC GTGATGGTGATGTTT
pOPINJ* N-terminal MAHHHHHHSSG-GST- LEVLFQInline graphicÞGP … pTriEx2/ampicillin T7lacO, CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements. AAGTTCTGTTTCAGGGCCCG‡ ATGGTCTAGAAAGCTTTA‡
pOPINM* N-terminal MAHHHHHHSSG-MBP- LEVLFQInline graphicGP … pTriEx2 ampicillin T7lacO, CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements. AAGTTCTGTTTCAGGGCCCG‡ ATGGTCTAGAAAGCTTTA‡

Inline graphic-represents the point of cleavage by 3C protease or signal peptidase (as appropriate). Vectors marked ‡ use the same primer extensions, enabling the same PCR product to be cloned into all marked vectors. Underlined sequences represent methionine initiation or stop codons (as appropriate) and may be excluded from the gene-specific primers.