Table 1.

Primers used for the various mutagenic protocols. The BamHI restriction sites for primer pairs P3 and P4 are underlined. The P3 primer pair was used with and without BamHI restriction digestion for the RE-mediated inverse PCR and inverse PCR methods, respectively.

Primer Pair	Primer	Length (bp)	Tm* (°C)	Primer Sequence (5' to 3')	Mutagenesis method
P1	A3consF	43	78	gctttatgatagtagtgatgctgataattataataaggaaagc	QuickChange™ site-directed method
	A3consR	43	78	gctttccttattataattatcagcatcactactatcataaagc
P2	A3overF	49	79	gatagtagtgatgctgat ↓ aattataataaggagagctttttatataatg	Overlapping primer method [19]
	A3overR	55	80	gctttccttattataatt ↓ atcagcatcactactatcataaagctttaaattatcc
P3	A3reF	27	73(62)	cgcggatccaattataataaggaaagc	ExSite™, inverse [18] and RE-mediated inverse PCR methods
	A3reR	34	79(69)	cgcggatccatcagcatcactactatcataaagc
P4	PdxkF	34	78(67)	cgcggatccaatctaaattttctttgggtatgtg	RE-mediated inverse PCR method
	PdxkR	38	79(67)	cgcggatcctttccttcttaattcaagtatatttttgg

* The Tm's were calculated according to the Stratagene formula: 81.5 + 0.41(%GC) - 675/N) or for primer pairs P3 and P4 with the Rychlik et al. formula: 69.3 + 0.41(%GC) - (650/N) [26] as indicated in parentheses.

↓ indicates where the deletions are made with the overlapping primers.